MD01G1046300.v1.1

tRNA-dihydrouridine20 synthase activity

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Reverse (-)
14719935 .. 14724215
4281 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1046300.v1.1.491

Sequence Viewer

Length: 579 bp
ATGTCGAATTTTGAATTCGAATACAAAATTTTCAATTGGTTCAAAGATTTCATGGCCAGGCTTAGCAATTTTGACGAGTTGGTGGCCACCGGAAGCACATTACTCGTCAACTTTCAGCAGGGGCTGGAGTTTCTTCGACGACCTCGGATAGATGAGACATCGGATTTGGTTAAAAACATAATCCGAGGTAATGAAACAAAGAAGGTTAAGTCATATGTTGAAGCTGGATGTCTCAACGCTGATGATGGCAGGCGAAATATAAGCAAGTTGCATACATGCCAACTTGGACTTTGTGACCATCTAAGTAAAGGCAGAAACGTACTTAATGAACTTGAATGCCTCCTGGAGGATGTAAATGGTGCAATGCGAACTGCAATGGGAAATTTACCCGACTTTCAGGGTGACAGTTTTGCGGACAGGTTGAATGAAGAAGCATGCAACGGTGACAAGGAGGAATTTACGTCATCCCATCCGAAAAGAAATGAAGTTATCGATTATGTTGTCGTGATGGGTGTCATTTACAGTATGGTCAAGCAAGACTATATGATGCAGGATTATGCTTGGAAACTTATTCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

193

Amino Acids

22.09

Weight (kDa)

5.06

Isoelectric Point (pI)

37.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7795 PF25071 6 - 125 6.4e-53 Domain of unknown function (DUF7795)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 413
AcoI YGGCCR 2 cut(s) 54, 84
AcsI RAATTY 5 cut(s) 7, 14, 27, 382, 455
AfaI GTAC 1 cut(s) 321
AfiI CCNNNNNNNGG 1 cut(s) 346
AgsI TTSAA 6 cut(s) 14, 34, 43, 221, 335, 424
AjnI CCWGG 2 cut(s) 56, 342
AluBI AGCT 1 cut(s) 224
AluI AGCT 1 cut(s) 224
Alw26I GTCTC 2 cut(s) 149, 236
AlwNI CAGNNNCTG 1 cut(s) 124
AoxI GGCC 2 cut(s) 54, 84
ApoI RAATTY 5 cut(s) 7, 14, 27, 382, 455
ArsI GACNNNNNNTTYG 2 cut(s) 148, 180
AsuHPI GGTGA 2 cut(s) 413, 455
AsuII TTCGAA 1 cut(s) 18
BalI TGGCCA 2 cut(s) 56, 86
BccI CCATC 4 cut(s) 239, 306, 477, 502
BcgI CGANNNNNNTGC 2 cut(s) 85, 119
BciT130I CCWGG 2 cut(s) 58, 344
BcoDI GTCTC 2 cut(s) 149, 236
BlpI GCTNAGC 1 cut(s) 62
Bme1390I CCNGG 2 cut(s) 58, 344
BmrFI CCNGG 2 cut(s) 58, 344
BmsI GCATC 1 cut(s) 537
BpmI CTGGAG 2 cut(s) 146, 365
Bpu1102I GCTNAGC 1 cut(s) 62
Bpu14I TTCGAA 1 cut(s) 18
Bsa29I ATCGAT 1 cut(s) 492
BsaJI CCNNGG 2 cut(s) 143, 184
BsaWI WCCGGW 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 346
Bse3DI GCAATG 2 cut(s) 369, 381
BseBI CCWGG 2 cut(s) 58, 344
BseCI ATCGAT 1 cut(s) 492
BseDI CCNNGG 2 cut(s) 143, 184
BseGI GGATG 4 cut(s) 233, 355, 464, 469
BseLI CCNNNNNNNGG 1 cut(s) 346
BseMI GCAATG 2 cut(s) 369, 381
BshFI GGCC 2 cut(s) 56, 86
BshVI ATCGAT 1 cut(s) 492
BsiSI CCGG 1 cut(s) 90
BslI CCNNNNNNNGG 1 cut(s) 346
BsmAI GTCTC 2 cut(s) 149, 236
BsmI GAATGC 1 cut(s) 341
BsnI GGCC 2 cut(s) 56, 86
Bsp119I TTCGAA 1 cut(s) 18
Bsp1720I GCTNAGC 1 cut(s) 62
BspACI CCGC 1 cut(s) 413
BspANI GGCC 2 cut(s) 56, 86
BspDI ATCGAT 1 cut(s) 492
BspT104I TTCGAA 1 cut(s) 18
BsrDI GCAATG 2 cut(s) 369, 381
BssECI CCNNGG 2 cut(s) 143, 184
Bst2UI CCWGG 2 cut(s) 58, 344
Bst4CI ACNGT 3 cut(s) 407, 443, 524
BstBI TTCGAA 1 cut(s) 18
BstC8I GCNNGC 2 cut(s) 251, 436
BstDEI CTNAG 2 cut(s) 62, 302
BstENI CCTNNNNNAGG 1 cut(s) 344
BstF5I GGATG 4 cut(s) 233, 355, 464, 469
BstMAI GTCTC 2 cut(s) 149, 236
BstNI CCWGG 2 cut(s) 58, 344
BstNSI RCATGY 2 cut(s) 279, 438
BstSCI CCNGG 2 cut(s) 56, 342
Bsu15I ATCGAT 1 cut(s) 492
BsuRI GGCC 2 cut(s) 56, 86
BsuTUI ATCGAT 1 cut(s) 492
BtsCI GGATG 4 cut(s) 233, 355, 464, 469
Cac8I GCNNGC 2 cut(s) 251, 436
CaiI CAGNNNCTG 1 cut(s) 124
ClaI ATCGAT 1 cut(s) 492
Csp6I GTAC 1 cut(s) 320
CviAII CATG 3 cut(s) 52, 276, 435
CviJI RGCY 5 cut(s) 56, 61, 86, 124, 224
CviKI_1 RGCY 5 cut(s) 56, 61, 86, 124, 224
CviQI GTAC 1 cut(s) 320
DdeI CTNAG 2 cut(s) 62, 302
EaeI YGGCCR 2 cut(s) 54, 84
EcoNI CCTNNNNNAGG 1 cut(s) 344
EcoRI GAATTC 1 cut(s) 14
EcoRII CCWGG 2 cut(s) 56, 342
FaeI CATG 3 cut(s) 55, 279, 438
FatI CATG 3 cut(s) 51, 275, 434
FauNDI CATATG 1 cut(s) 214
FokI GGATG 4 cut(s) 240, 362, 451, 456
GsuI CTGGAG 2 cut(s) 146, 365
HaeIII GGCC 2 cut(s) 56, 86
HapII CCGG 1 cut(s) 90
Hin1II CATG 3 cut(s) 55, 279, 438
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HpaII CCGG 1 cut(s) 90
HphI GGTGA 2 cut(s) 413, 455
Hpy166II GTNNAC 1 cut(s) 109
Hpy188I TCNGA 4 cut(s) 147, 163, 185, 474
Hpy188III TCNNGA 1 cut(s) 505
Hpy8I GTNNAC 1 cut(s) 109
Hpy99I CGWCG 1 cut(s) 141
HpyAV CCTTC 1 cut(s) 196
HpyCH4III ACNGT 3 cut(s) 407, 443, 524
HpyCH4IV ACGT 2 cut(s) 318, 461
HpyCH4V TGCA 5 cut(s) 271, 362, 374, 438, 550
HpyF3I CTNAG 2 cut(s) 62, 302
HpySE526I ACGT 2 cut(s) 318, 461
Hsp92II CATG 3 cut(s) 55, 279, 438
LweI GCATC 1 cut(s) 537
MaeII ACGT 2 cut(s) 318, 461
MaeIII GTNAC 3 cut(s) 293, 401, 443
MboII GAAGA 2 cut(s) 125, 440
MfeI CAATTG 1 cut(s) 34
MlsI TGGCCA 2 cut(s) 56, 86
MluCI AATT 7 cut(s) 7, 14, 27, 34, 67, 382, 455
MluNI TGGCCA 2 cut(s) 56, 86
MnlI CCTC 5 cut(s) 153, 179, 340, 350, 445
Mox20I TGGCCA 2 cut(s) 56, 86
MscI TGGCCA 2 cut(s) 56, 86
MseI TTAA 3 cut(s) 171, 207, 324
Msp20I TGGCCA 2 cut(s) 56, 86
MspI CCGG 1 cut(s) 90
MspR9I CCNGG 2 cut(s) 58, 344
MunI CAATTG 1 cut(s) 34
Mva1269I GAATGC 1 cut(s) 341
MvaI CCWGG 2 cut(s) 58, 344
NdeI CATATG 1 cut(s) 214
NlaIII CATG 3 cut(s) 55, 279, 438
NmuCI GTSAC 3 cut(s) 293, 401, 443
NspI RCATGY 2 cut(s) 279, 438
NspV TTCGAA 1 cut(s) 18
PaeI GCATGC 1 cut(s) 438
PctI GAATGC 1 cut(s) 341
PfoI TCCNGGA 1 cut(s) 342
Psp6I CCWGG 2 cut(s) 56, 342
PspGI CCWGG 2 cut(s) 56, 342
PstNI CAGNNNCTG 1 cut(s) 124
RsaI GTAC 1 cut(s) 321
RsaNI GTAC 1 cut(s) 320
SaqAI TTAA 3 cut(s) 171, 207, 324
ScrFI CCNGG 2 cut(s) 58, 344
SetI ASST 7 cut(s) 145, 190, 207, 226, 321, 422, 464
SfaNI GCATC 1 cut(s) 537
SfuI TTCGAA 1 cut(s) 18
SphI GCATGC 1 cut(s) 438
Sse9I AATT 7 cut(s) 7, 14, 27, 34, 67, 382, 455
SsiI CCGC 1 cut(s) 413
StyD4I CCNGG 2 cut(s) 56, 342
TaaI ACNGT 3 cut(s) 407, 443, 524
TaiI ACGT 2 cut(s) 321, 464
TaqI TCGA 4 cut(s) 5, 18, 136, 492
TasI AATT 7 cut(s) 7, 14, 27, 34, 67, 382, 455
Tru1I TTAA 3 cut(s) 171, 207, 324
Tru9I TTAA 3 cut(s) 171, 207, 324
TseFI GTSAC 3 cut(s) 293, 401, 443
Tsp45I GTSAC 3 cut(s) 293, 401, 443
TspDTI ATGAA 5 cut(s) 40, 207, 342, 441, 498
XagI CCTNNNNNAGG 1 cut(s) 344
XapI RAATTY 5 cut(s) 7, 14, 27, 382, 455
XceI RCATGY 2 cut(s) 279, 438
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.