MD04G1240700.v1.1

tRNA-dihydrouridine20 synthase activity

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Reverse (-)
31816268 .. 31817051
784 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1240700.v1.1.491

Sequence Viewer

Length: 174 bp
ATGGGGGTCATTTACAGTATGGTCAAGCAAGACTATATGATGCAGGAGAGGATCGTCTCTGCTCTTAATCTCAAATCATCTTCAGGAGAATTAGAGAGCTACTGCCTGATGTGGTCTTTGCGTCCGTTCATAAATAACGAAATTATGGATTATGCTTGGAAACTTATTCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.72

Weight (kDa)

5.05

Isoelectric Point (pI)

50.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 59
AcuI CTGAAG 1 cut(s) 66
AluBI AGCT 1 cut(s) 99
AluI AGCT 1 cut(s) 99
Alw26I GTCTC 1 cut(s) 61
AlwI GGATC 1 cut(s) 59
BcoDI GTCTC 1 cut(s) 61
BmsI GCATC 1 cut(s) 30
BsmAI GTCTC 1 cut(s) 61
BsmBI CGTCTC 1 cut(s) 61
Bsp143I GATC 1 cut(s) 51
BspPI GGATC 1 cut(s) 59
BssMI GATC 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 17
BstKTI GATC 1 cut(s) 54
BstMAI GTCTC 1 cut(s) 61
BstMBI GATC 1 cut(s) 51
CseI GACGC 1 cut(s) 110
CviJI RGCY 1 cut(s) 99
CviKI_1 RGCY 1 cut(s) 99
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
Eco57I CTGAAG 1 cut(s) 66
Esp3I CGTCTC 1 cut(s) 61
FaiI YATR 6 cut(s) 20, 36, 38, 131, 146, 153
FspEI CC 9 cut(s) 5, 29, 34, 69, 97, 119, 131, 138, 142
HgaI GACGC 1 cut(s) 110
Hpy188III TCNNGA 1 cut(s) 84
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4V TGCA 1 cut(s) 43
Kzo9I GATC 1 cut(s) 51
LpnPI CCDG 3 cut(s) 29, 69, 119
LweI GCATC 1 cut(s) 30
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MboII GAAGA 1 cut(s) 72
MluCI AATT 2 cut(s) 89, 141
MnlI CCTC 1 cut(s) 42
MseI TTAA 1 cut(s) 66
NdeII GATC 1 cut(s) 51
SaqAI TTAA 1 cut(s) 66
Sau3AI GATC 1 cut(s) 51
SetI ASST 1 cut(s) 101
SfaNI GCATC 1 cut(s) 30
SgeI CNNG 6 cut(s) 37, 41, 56, 96, 118, 168
Sse9I AATT 2 cut(s) 89, 141
TaaI ACNGT 1 cut(s) 17
TasI AATT 2 cut(s) 89, 141
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TspDTI ATGAA 1 cut(s) 118
TspGWI ACGGA 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.