Rroxscaffold_4G00326300

tRNA-dihydrouridine20 synthase activity

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
58356890 .. 58357326
437 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00326300.1

Sequence Viewer

Length: 174 bp
ATGGCTGTCATTTATCGTATGGTCAAGCAAGAATATATGATGCAGGAAAGAATTGTTTCTACGTTAAGTCTCAAGTCATCTTTCGGAGAATTAGAGAGCTACTGCCTTATGTGGTCTTTGCGTCCTTACATAGATGAAGAAATTATGGGTCATGCTTGGAAACTTATACACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.87

Weight (kDa)

6.04

Isoelectric Point (pI)

47.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 99
AluI AGCT 1 cut(s) 99
Alw26I GTCTC 1 cut(s) 74
Asp700I GAANNNNTTC 1 cut(s) 55
BcoDI GTCTC 1 cut(s) 74
BmsI GCATC 1 cut(s) 30
BpuEI CTTGAG 1 cut(s) 56
BsmAI GTCTC 1 cut(s) 74
BstMAI GTCTC 1 cut(s) 74
BtsIMutI CAGTG 1 cut(s) 169
CseI GACGC 1 cut(s) 110
CviAII CATG 1 cut(s) 152
CviJI RGCY 2 cut(s) 5, 99
CviKI_1 RGCY 2 cut(s) 5, 99
FaeI CATG 1 cut(s) 155
FaiI YATR 8 cut(s) 20, 36, 38, 110, 131, 146, 153, 167
FatI CATG 1 cut(s) 151
FspEI CC 9 cut(s) 5, 29, 69, 97, 119, 131, 132, 138, 142
HgaI GACGC 1 cut(s) 110
Hin1II CATG 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 86
HpyCH4IV ACGT 1 cut(s) 62
HpyCH4V TGCA 1 cut(s) 43
HpySE526I ACGT 1 cut(s) 62
Hsp92II CATG 1 cut(s) 155
LpnPI CCDG 1 cut(s) 29
LweI GCATC 1 cut(s) 30
MaeII ACGT 1 cut(s) 62
MboII GAAGA 1 cut(s) 149
MluCI AATT 3 cut(s) 51, 89, 141
MroXI GAANNNNTTC 1 cut(s) 55
MseI TTAA 1 cut(s) 65
NlaIII CATG 1 cut(s) 155
PdmI GAANNNNTTC 1 cut(s) 55
SaqAI TTAA 1 cut(s) 65
SetI ASST 2 cut(s) 65, 101
SfaNI GCATC 1 cut(s) 30
SgeI CNNG 6 cut(s) 37, 41, 56, 85, 164, 168
SmlI CTYRAG 1 cut(s) 71
SmoI CTYRAG 1 cut(s) 71
Sse9I AATT 3 cut(s) 51, 89, 141
TaiI ACGT 1 cut(s) 65
TasI AATT 3 cut(s) 51, 89, 141
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 150
XmnI GAANNNNTTC 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.