Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006223.1

Orthogroup ID

OG0001304

Physical Location & Seq

Genomic Coordinates Reverse (-)

25634 .. 27736

Gene Structure 2103 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006223.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1362 bp

atggggaaatcatctctgcctcctggttttcggttcaatcctactgatgttgagctggtacaatattatttgaagaggaaggtaatgggaaagagactccctgttaaagttgttgctgaggtcgacatttacaaatgggctccttgggatcttccagacaagtcttgttggcgaagtggagatttgaagtggtacttcttttgtcctagagagaaaaaatatgcaagtggagctagaatgaatcgtgccactgaccgtggttactggaaaaccacaggaaaggatagatctgttctttacagtaatgaagttgttgggtggattaaaacattaattttccacaccggtcgagctccacgaggacagcggactgattgggttttacatgagtataggcttgaagacaagaaactggttgatatgggtgtgcctcaggattcttatgtgctctgtatggttttccaaaaggatgggataggaccaagaagcaataaacaatatggtgcacccttcaaagaggaagattggactgatgatgaggttgaaactgatgtagttccacatgtaaacatgtctgagccaaaccttgttcatgcaaacattcatcagccagagccacatcttattcattcaaacatgcctgagccagaccttgttcaagcaaacatacctgatcaagtacctgttaattcaaacatcactgagcccgatcttgtttatggaaacatgcccgacccataccttgtttatccaaacatgcctgaatcagaccttcattatgcaaacatgcctcaatcagaccttggttatgcaaacatgtctgagccatcccttgtcttgcccagcaactataatagctctattgctactcgcaccaattcccgtgcgtcttgtgtttctgatatcttgccaccttctagcaatgttctgcagtctgtttccagtaattatgttacaacagagaaacctcatgtttcaactgatgatgatatgatgtctatgcttaattgctttacagaagaaggaactttctccatgagtgacattgacaaaaatgagcagcttgataatctcatttattctggggacgctaatcctatagctgattttgaaagacatgatgatgctcatgaagatcggggaggattgagcaaaaatggatataatatccccaatggagctacgtctggagctccaggtgagaatgagccatatctggagctagttgatcttgacaaacctttgaatggcaataattccctgtttccaatgattagtccacctcatacttttcttggagagacaccttatgaagactcgttgttccatggagtgatgacttatgaagactggatgtgctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0006355 GO:0008150 GO:0009314 GO:0009416 GO:0009628 GO:0009642 GO:0009644 GO:0009889 GO:0009891 GO:0009893 GO:0009962 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010628 GO:0019219 GO:0019222 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0045893 GO:0045935 GO:0048518 GO:0048522 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051173 GO:0051252 GO:0051254 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1902680 GO:1903506 GO:1903508 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NAM

Protein Analysis

453

Amino Acids

51.29

Weight (kDa)

4.82

Isoelectric Point (pI)

48.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001304)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G49645 AT3G49645
fragaria_vesca	FvH4_1g18830 FvH4_1g18830 FvH4_1g18830 FvH4_1g18830 FvH4_1g18830 FvH4_2g13330 FvH4_2g13330 FvH4_2g13330
malus_domestica	MD00G1139600.v1.1 MD01G1046300.v1.1 MD04G1240700.v1.1 MD15G1405500.v1.1
prunus_persica	Prupe.6G211100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0109701 RchiOBHm_Chr5g0054161 RchiOBHm_Chr6g0274761
rosa_laevigata	RLG00000013524 RLG00000017757 RLG00000017758 RLG00000030253 RLG00000030255 RLG00000030257 RLG00000030259 RLG00000030260 RLG00000030262 RLG00000030263
rosa_multiflora	Rmu_sc0000507.1_g000008 Rmu_sc0000509.1_g000038 Rmu_sc0001938.1_g000001 Rmu_sc0002076.1_g000012 Rmu_sc0006223.1_g000006 Rmu_sc0006889.1_g000015
rosa_roxburghii	Rroxscaffold_2G00134010 Rroxscaffold_4G00326300 Rroxscaffold_4G00326330 Rroxscaffold_7G00193960
rosa_rugosa	Rorug02G0162000 Rorug06G0083900 Rorug06G0084000 Rorug06G0084100
rosa_samantha	Rh2AG214500 Rh2BG224800 Rh2CG216700 Rh2DG220000 Rh5AG354600 Rh6AG199700 Rh6BG203400 Rh6CG203600 Rh6DG195100
rosa_wichuraiana	Rw0G009640 Rw1G004950 Rw6G017370

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	123
AciI	CCGC	1 cut(s)	367
AclWI	GGATC	1 cut(s)	156
AfaI	GTAC	3 cut(s)	60, 194, 681
AfiI	CCNNNNNNNGG	1 cut(s)	1247
AflIII	ACRYGT	3 cut(s)	562, 570, 816
AgeI	ACCGGT	1 cut(s)	344
AjnI	CCWGG	2 cut(s)	22, 1195
AluBI	AGCT	9 cut(s)	55, 233, 353, 858, 1063, 1103, 1181, 1193, 1222
AluI	AGCT	9 cut(s)	55, 233, 353, 858, 1063, 1103, 1181, 1193, 1222
Alw21I	GWGCWC	4 cut(s)	355, 450, 508, 1195
Alw26I	GTCTC	2 cut(s)	88, 1295
Alw44I	GTGCAC	1 cut(s)	504
AlwI	GGATC	1 cut(s)	156
ApaLI	GTGCAC	1 cut(s)	504
ApeKI	GCWGC	1 cut(s)	1060
AseI	ATTAAT	1 cut(s)	332
AsiGI	ACCGGT	1 cut(s)	344
AspS9I	GGNCC	1 cut(s)	479
AsuHPI	GGTGA	1 cut(s)	1211
AvaII	GGWCC	1 cut(s)	479
AxyI	CCTNAGG	1 cut(s)	432
BaeGI	GKGCMC	1 cut(s)	508
BanII	GRGCYC	4 cut(s)	142, 355, 708, 1195
BauI	CACGAG	1 cut(s)	357
BbsI	GAAGAC	3 cut(s)	408, 1320, 1353
Bbv12I	GWGCWC	4 cut(s)	355, 450, 508, 1195
BbvCI	CCTCAGC	1 cut(s)	117
BbvI	GCAGC	1 cut(s)	1072
BccI	CCATC	2 cut(s)	464, 835
BciT130I	CCWGG	2 cut(s)	24, 1197
BclI	TGATCA	1 cut(s)	673
BcoDI	GTCTC	2 cut(s)	88, 1295
BfaI	CTAG	4 cut(s)	207, 234, 918, 1223
BfmI	CTRYAG	2 cut(s)	929, 1098
BglII	AGATCT	1 cut(s)	287
BisI	GCNGC	1 cut(s)	1061
BlsI	GCNGC	1 cut(s)	1062
Bme1390I	CCNGG	2 cut(s)	24, 1197
Bme18I	GGWCC	1 cut(s)	479
BmgT120I	GGNCC	1 cut(s)	479
BmiI	GGNNCC	1 cut(s)	141
BmrFI	CCNGG	2 cut(s)	24, 1197
BmsI	GCATC	1 cut(s)	1114
BpiI	GAAGAC	3 cut(s)	408, 1320, 1353
BpmI	CTGGAG	3 cut(s)	1179, 1209, 1238
Bpu10I	CCTNAGC	2 cut(s)	117, 642
BsaJI	CCNNGG	4 cut(s)	143, 256, 802, 1327
BsaWI	WCCGGW	1 cut(s)	344
Bsc4I	CCNNNNNNNGG	1 cut(s)	1247
Bse118I	RCCGGY	1 cut(s)	344
Bse1I	ACTGG	4 cut(s)	269, 417, 942, 1355
Bse21I	CCTNAGG	1 cut(s)	432
Bse3DI	GCAATG	1 cut(s)	928
BseBI	CCWGG	2 cut(s)	24, 1197
BseDI	CCNNGG	4 cut(s)	143, 256, 802, 1327
BseGI	GGATG	3 cut(s)	475, 827, 1359
BseLI	CCNNNNNNNGG	1 cut(s)	1247
BseMI	GCAATG	1 cut(s)	928
BseMII	CTCAG	6 cut(s)	108, 446, 567, 633, 693, 813
BseNI	ACTGG	4 cut(s)	269, 417, 942, 1355
BseSI	GKGCMC	1 cut(s)	508
BseXI	GCAGC	1 cut(s)	1072
BseYI	CCCAGC	1 cut(s)	842
Bsh1285I	CGRYCG	1 cut(s)	349
BshTI	ACCGGT	1 cut(s)	344
BsiEI	CGRYCG	1 cut(s)	349
BsiHKAI	GWGCWC	4 cut(s)	355, 450, 508, 1195
BsiSI	CCGG	1 cut(s)	345
BslFI	GGGAC	1 cut(s)	1100
BslI	CCNNNNNNNGG	1 cut(s)	1247
BsmAI	GTCTC	2 cut(s)	88, 1295
BsmFI	GGGAC	1 cut(s)	1100
Bsp1286I	GDGCHC	6 cut(s)	142, 355, 450, 508, 708, 1195
Bsp143I	GATC	6 cut(s)	148, 287, 673, 709, 1135, 1228
Bsp19I	CCATGG	1 cut(s)	1327
BspACI	CCGC	1 cut(s)	367
BspCNI	CTCAG	6 cut(s)	109, 445, 568, 634, 694, 814
BspHI	TCATGA	1 cut(s)	1129
BspLI	GGNNCC	1 cut(s)	141
BspMAI	CTGCAG	1 cut(s)	933
BspPI	GGATC	1 cut(s)	156
BsrDI	GCAATG	1 cut(s)	928
BsrFI	RCCGGY	1 cut(s)	344
BsrI	ACTGG	4 cut(s)	269, 417, 942, 1355
BssAI	RCCGGY	1 cut(s)	344
BssECI	CCNNGG	4 cut(s)	143, 256, 802, 1327
BssMI	GATC	6 cut(s)	148, 287, 673, 709, 1135, 1228
BssSI	CACGAG	1 cut(s)	357
BssT1I	CCWWGG	3 cut(s)	143, 802, 1327
Bst2BI	CACGAG	1 cut(s)	357
Bst2UI	CCWGG	2 cut(s)	24, 1197
Bst4CI	ACNGT	2 cut(s)	257, 302
Bst6I	CTCTTC	1 cut(s)	68
BstDEI	CTNAG	6 cut(s)	117, 432, 576, 642, 702, 822
BstDSI	CCRYGG	2 cut(s)	256, 1327
BstF5I	GGATG	3 cut(s)	475, 827, 1359
BstKTI	GATC	6 cut(s)	151, 290, 676, 712, 1138, 1231
BstMAI	GTCTC	2 cut(s)	88, 1295
BstMBI	GATC	6 cut(s)	148, 287, 673, 709, 1135, 1228
BstMCI	CGRYCG	1 cut(s)	349
BstMWI	GCNNNNNNNGC	1 cut(s)	230
BstNI	CCWGG	2 cut(s)	24, 1197
BstNSI	RCATGY	7 cut(s)	566, 574, 640, 730, 760, 790, 820
BstSCI	CCNGG	2 cut(s)	22, 1195
BstSFI	CTRYAG	2 cut(s)	929, 1098
BstSLI	GKGCMC	1 cut(s)	508
BstV1I	GCAGC	1 cut(s)	1072
BstV2I	GAAGAC	3 cut(s)	408, 1320, 1353
BstX2I	RGATCY	2 cut(s)	148, 287
BstXI	CCANNNNNNTGG	1 cut(s)	470
BstYI	RGATCY	2 cut(s)	148, 287
Bsu36I	CCTNAGG	1 cut(s)	432
BtgI	CCRYGG	2 cut(s)	256, 1327
BtsCI	GGATG	3 cut(s)	475, 827, 1359
BtsIMutI	CAGTG	2 cut(s)	249, 699
CciI	TCATGA	1 cut(s)	1129
Cfr10I	RCCGGY	1 cut(s)	344
Cfr13I	GGNCC	1 cut(s)	479
CseI	GACGC	2 cut(s)	876, 1097
Csp6I	GTAC	3 cut(s)	59, 193, 680
CspAI	ACCGGT	1 cut(s)	344
CviQI	GTAC	3 cut(s)	59, 193, 680
DdeI	CTNAG	6 cut(s)	117, 432, 576, 642, 702, 822
DpnI	GATC	6 cut(s)	150, 289, 675, 711, 1137, 1230
DpnII	GATC	6 cut(s)	148, 287, 673, 709, 1135, 1228
Eam1104I	CTCTTC	1 cut(s)	68
EarI	CTCTTC	1 cut(s)	68
Ecl136II	GAGCTC	2 cut(s)	353, 1193
Eco130I	CCWWGG	3 cut(s)	143, 802, 1327
Eco24I	GRGCYC	4 cut(s)	142, 355, 708, 1195
Eco32I	GATATC	1 cut(s)	904
Eco47I	GGWCC	1 cut(s)	479
Eco53kI	GAGCTC	2 cut(s)	353, 1193
Eco81I	CCTNAGG	1 cut(s)	432
EcoICRI	GAGCTC	2 cut(s)	353, 1193
EcoRII	CCWGG	2 cut(s)	22, 1195
EcoRV	GATATC	1 cut(s)	904
EcoT14I	CCWWGG	3 cut(s)	143, 802, 1327
EcoT38I	GRGCYC	4 cut(s)	142, 355, 708, 1195
ErhI	CCWWGG	3 cut(s)	143, 802, 1327
FalI	AAGNNNNNCTT	2 cut(s)	179, 211
FaqI	GGGAC	1 cut(s)	1100
FbaI	TGATCA	1 cut(s)	673
FblI	GTMKAC	1 cut(s)	123
Fnu4HI	GCNGC	1 cut(s)	1061
FokI	GGATG	2 cut(s)	482, 814
FriOI	GRGCYC	4 cut(s)	142, 355, 708, 1195
Fsp4HI	GCNGC	1 cut(s)	1061
FspBI	CTAG	4 cut(s)	207, 234, 918, 1223
GluI	GCNGC	1 cut(s)	1061
GsaI	CCCAGC	1 cut(s)	846
GsuI	CTGGAG	3 cut(s)	1179, 1209, 1238
HapII	CCGG	1 cut(s)	345
HgaI	GACGC	2 cut(s)	876, 1097
HincII	GTYRAC	1 cut(s)	124
HindII	GTYRAC	1 cut(s)	124
HinfI	GANTC	5 cut(s)	96, 241, 437, 764, 1316
HpaII	CCGG	1 cut(s)	345
HphI	GGTGA	1 cut(s)	1211
Hpy166II	GTNNAC	4 cut(s)	124, 506, 568, 1280
Hpy188I	TCNGA	5 cut(s)	577, 769, 799, 823, 901
Hpy188III	TCNNGA	6 cut(s)	155, 434, 1130, 1188, 1217, 1232
Hpy8I	GTNNAC	4 cut(s)	124, 506, 568, 1280
HpyAV	CCTTC	5 cut(s)	73, 520, 782, 924, 1016
HpyCH4III	ACNGT	2 cut(s)	257, 302
HpyCH4IV	ACGT	1 cut(s)	1184
HpyCH4V	TGCA	6 cut(s)	224, 506, 596, 782, 812, 931
HpyF10VI	GCNNNNNNNGC	1 cut(s)	230
HpyF3I	CTNAG	6 cut(s)	117, 432, 576, 642, 702, 822
HpySE526I	ACGT	1 cut(s)	1184
Ksp22I	TGATCA	1 cut(s)	673
Kzo9I	GATC	6 cut(s)	148, 287, 673, 709, 1135, 1228
LmnI	GCTCC	7 cut(s)	145, 230, 358, 1178, 1190, 1198, 1219
Lsp1109I	GCAGC	1 cut(s)	1072
LweI	GCATC	1 cut(s)	1114
MaeI	CTAG	4 cut(s)	207, 234, 918, 1223
MaeII	ACGT	1 cut(s)	1184
MaeIII	GTNAC	3 cut(s)	260, 952, 1040
MalI	GATC	6 cut(s)	150, 289, 675, 711, 1137, 1230
MboI	GATC	6 cut(s)	148, 287, 673, 709, 1135, 1228
MboII	GAAGA	8 cut(s)	85, 143, 413, 533, 1031, 1145, 1325, 1358
MflI	RGATCY	2 cut(s)	148, 287
MhlI	GDGCHC	6 cut(s)	142, 355, 450, 508, 708, 1195
MluCI	AATT	6 cut(s)	333, 688, 877, 946, 1006, 1255
MlyI	GAGTC	2 cut(s)	90, 1310
MseI	TTAA	5 cut(s)	105, 324, 332, 687, 1005
MslI	CAYNNNNRTG	1 cut(s)	1122
MspA1I	CMGCKG	1 cut(s)	367
MspI	CCGG	1 cut(s)	345
MspR9I	CCNGG	2 cut(s)	24, 1197
MvaI	CCWGG	2 cut(s)	24, 1197
MwoI	GCNNNNNNNGC	1 cut(s)	230
NcoI	CCATGG	1 cut(s)	1327
NdeII	GATC	6 cut(s)	148, 287, 673, 709, 1135, 1228
NlaIV	GGNNCC	1 cut(s)	141
NmuCI	GTSAC	1 cut(s)	1040
NspI	RCATGY	7 cut(s)	566, 574, 640, 730, 760, 790, 820
PagI	TCATGA	1 cut(s)	1129
PciI	ACATGT	3 cut(s)	562, 570, 816
PcsI	WCGNNNNNNNCGW	1 cut(s)	355
PfeI	GAWTC	3 cut(s)	241, 437, 764
PinAI	ACCGGT	1 cut(s)	344
PkrI	GCNGC	1 cut(s)	1062
PleI	GAGTC	2 cut(s)	90, 1310
PpsI	GAGTC	2 cut(s)	90, 1310
PscI	ACATGT	3 cut(s)	562, 570, 816
PshBI	ATTAAT	1 cut(s)	332
Psp124BI	GAGCTC	2 cut(s)	355, 1195
Psp6I	CCWGG	2 cut(s)	22, 1195
PspFI	CCCAGC	1 cut(s)	842
PspGI	CCWGG	2 cut(s)	22, 1195
PspN4I	GGNNCC	1 cut(s)	141
PspPI	GGNCC	1 cut(s)	479
PstI	CTGCAG	1 cut(s)	933
PsuI	RGATCY	2 cut(s)	148, 287
RsaI	GTAC	3 cut(s)	60, 194, 681
RsaNI	GTAC	3 cut(s)	59, 193, 680
RseI	CAYNNNNRTG	1 cut(s)	1122
SacI	GAGCTC	2 cut(s)	355, 1195
SalI	GTCGAC	1 cut(s)	122
SaqAI	TTAA	5 cut(s)	105, 324, 332, 687, 1005
SatI	GCNGC	1 cut(s)	1061
Sau3AI	GATC	6 cut(s)	148, 287, 673, 709, 1135, 1228
Sau96I	GGNCC	1 cut(s)	479
SchI	GAGTC	2 cut(s)	90, 1310
ScrFI	CCNGG	2 cut(s)	24, 1197
SduI	GDGCHC	6 cut(s)	142, 355, 450, 508, 708, 1195
SfaNI	GCATC	1 cut(s)	1114
SfcI	CTRYAG	2 cut(s)	929, 1098
SinI	GGWCC	1 cut(s)	479
SmiMI	CAYNNNNRTG	1 cut(s)	1122
Sse9I	AATT	6 cut(s)	333, 688, 877, 946, 1006, 1255
SsiI	CCGC	1 cut(s)	367
SspI	AATATT	1 cut(s)	65
SspMI	CTAG	4 cut(s)	207, 234, 918, 1223
SstI	GAGCTC	2 cut(s)	355, 1195
StyD4I	CCNGG	2 cut(s)	22, 1195
StyI	CCWWGG	3 cut(s)	143, 802, 1327
TaaI	ACNGT	2 cut(s)	257, 302
TaiI	ACGT	1 cut(s)	1187
TaqI	TCGA	2 cut(s)	123, 349
TasI	AATT	6 cut(s)	333, 688, 877, 946, 1006, 1255
TfiI	GAWTC	3 cut(s)	241, 437, 764
Tru1I	TTAA	5 cut(s)	105, 324, 332, 687, 1005
Tru9I	TTAA	5 cut(s)	105, 324, 332, 687, 1005
TscAI	CASTG	2 cut(s)	256, 706
TseFI	GTSAC	1 cut(s)	1040
TseI	GCWGC	1 cut(s)	1060
Tsp45I	GTSAC	1 cut(s)	1040
TspDTI	ATGAA	9 cut(s)	254, 321, 581, 593, 617, 764, 1146, 1326, 1359
TspRI	CASTG	2 cut(s)	256, 706
VneI	GTGCAC	1 cut(s)	504
VpaK11BI	GGWCC	1 cut(s)	479
VspI	ATTAAT	1 cut(s)	332
XceI	RCATGY	7 cut(s)	566, 574, 640, 730, 760, 790, 820
XmiI	GTMKAC	1 cut(s)	123
XspI	CTAG	4 cut(s)	207, 234, 918, 1223

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.