Rmu_sc0006889.1_g000015

tRNA-dihydrouridine20 synthase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006889.1
Physical Location & Seq
Forward (+)
51814 .. 52834
1021 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006889.1_g000015.1.cds

Sequence Viewer

Length: 306 bp
atgcaagataaatccttgttccaggatgacaatttgggtgaaaggttgaatgaacaagcatgtatcaatgacaaggaggaaattgcctcgccttgtcccagaagaaatgaagttactgattatgctgtcctgatggcagtcatttatcgtatggtcaagcaagaatatatgatgcaggaaagaattgtttctgcattaagtctcaagtcatcttccggagaattagagagctactgccttatgtggtctttgcgtccttacatagatgaagaaattatgggtcatgcttggaaacttatacactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.83

Weight (kDa)

4.83

Isoelectric Point (pI)

58.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 215
AgsI TTSAA 1 cut(s) 49
AjnI CCWGG 1 cut(s) 21
AluBI AGCT 1 cut(s) 231
AluI AGCT 1 cut(s) 231
Alw26I GTCTC 1 cut(s) 206
Aor13HI TCCGGA 1 cut(s) 215
Asp700I GAANNNNTTC 1 cut(s) 187
AsuHPI GGTGA 1 cut(s) 50
BccI CCATC 1 cut(s) 127
BciT130I CCWGG 1 cut(s) 23
BcoDI GTCTC 1 cut(s) 206
Bme1390I CCNGG 1 cut(s) 23
BmrFI CCNGG 1 cut(s) 23
BmsI GCATC 1 cut(s) 162
BpuEI CTTGAG 1 cut(s) 188
BsaWI WCCGGW 1 cut(s) 215
BseAI TCCGGA 1 cut(s) 215
BseBI CCWGG 1 cut(s) 23
BseGI GGATG 1 cut(s) 31
BsiSI CCGG 1 cut(s) 216
BslFI GGGAC 1 cut(s) 81
BsmAI GTCTC 1 cut(s) 206
BsmFI GGGAC 1 cut(s) 81
Bsp13I TCCGGA 1 cut(s) 215
BspEI TCCGGA 1 cut(s) 215
Bst2UI CCWGG 1 cut(s) 23
BstF5I GGATG 1 cut(s) 31
BstMAI GTCTC 1 cut(s) 206
BstNI CCWGG 1 cut(s) 23
BstNSI RCATGY 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 21
BtsCI GGATG 1 cut(s) 31
BtsIMutI CAGTG 1 cut(s) 301
CseI GACGC 1 cut(s) 242
CviAII CATG 2 cut(s) 60, 284
CviJI RGCY 1 cut(s) 231
CviKI_1 RGCY 1 cut(s) 231
EcoRII CCWGG 1 cut(s) 21
FaeI CATG 2 cut(s) 63, 287
FaqI GGGAC 1 cut(s) 81
FatI CATG 2 cut(s) 59, 283
FokI GGATG 1 cut(s) 38
HapII CCGG 1 cut(s) 216
HgaI GACGC 1 cut(s) 242
Hin1II CATG 2 cut(s) 63, 287
HpaII CCGG 1 cut(s) 216
HphI GGTGA 1 cut(s) 50
Hpy188III TCNNGA 2 cut(s) 130, 216
HpyCH4V TGCA 3 cut(s) 4, 175, 194
Hsp92II CATG 2 cut(s) 63, 287
Kpn2I TCCGGA 1 cut(s) 215
LpnPI CCDG 6 cut(s) 8, 35, 112, 143, 161, 229
LweI GCATC 1 cut(s) 162
MaeIII GTNAC 1 cut(s) 112
MboII GAAGA 3 cut(s) 114, 204, 281
MluCI AATT 5 cut(s) 31, 81, 183, 221, 273
MnlI CCTC 2 cut(s) 70, 97
MroI TCCGGA 1 cut(s) 215
MroXI GAANNNNTTC 1 cut(s) 187
MseI TTAA 1 cut(s) 197
MspI CCGG 1 cut(s) 216
MspR9I CCNGG 1 cut(s) 23
MvaI CCWGG 1 cut(s) 23
NlaIII CATG 2 cut(s) 63, 287
NspI RCATGY 1 cut(s) 63
PdmI GAANNNNTTC 1 cut(s) 187
PfoI TCCNGGA 1 cut(s) 21
Psp6I CCWGG 1 cut(s) 21
PspGI CCWGG 1 cut(s) 21
SaqAI TTAA 1 cut(s) 197
ScrFI CCNGG 1 cut(s) 23
SetI ASST 2 cut(s) 47, 233
SfaNI GCATC 1 cut(s) 162
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 5 cut(s) 31, 81, 183, 221, 273
StyD4I CCNGG 1 cut(s) 21
TasI AATT 5 cut(s) 31, 81, 183, 221, 273
Tru1I TTAA 1 cut(s) 197
Tru9I TTAA 1 cut(s) 197
TspDTI ATGAA 3 cut(s) 66, 123, 282
XceI RCATGY 1 cut(s) 63
XmnI GAANNNNTTC 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.