Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr05

Orthogroup ID

OG0002863

Physical Location & Seq

Genomic Coordinates Reverse (-)

45892890 .. 45893060

Gene Structure 171 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD05G1337200.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 171 bp

ATGAGATGCATCCATATTGGGTTGCTATGTGTGCAAGAAAATATAGCTGATAGGCCAACCATGAATGCTATTGTTCTAATGCTTAACAGTTACTCAGTCACACTTCCAGTACCCTCACAACCATCATTTTTCGGAGATAGTAACGTTGGATTTGACATGACTTTGGGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006950 GO:0006952 GO:0008150 GO:0008152 GO:0009605 GO:0009607 GO:0009617 GO:0009719 GO:0009725 GO:0009737 GO:0009987 GO:0010033 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0033993 GO:0036211 GO:0042221 GO:0042742 GO:0043170 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0050896 GO:0051704 GO:0051707 GO:0071704 GO:0071944 GO:0097305 GO:0098542 GO:0140096 GO:1901564 GO:1901700

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr Stress-antifung

Protein Analysis

57

Amino Acids

6.12

Weight (kDa)

4.66

Isoelectric Point (pI)

53.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002863)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g02801
malus_domestica	MD05G1337200.v1.1 MD07G1013600.v1.1 MD07G1013800.v1.1 MD14G1206900.v1.1
prunus_persica	Prupe.4G028300_v2.0.a1
pyrus_communis	pycom08g11830 pycom10g26440 pycom11g01830
rosa_chinensis	RchiOBHm_Chr2g0114621 RchiOBHm_Chr2g0114771 RchiOBHm_Chr2g0114811 RchiOBHm_Chr5g0033421 RchiOBHm_Chr5g0033511 RchiOBHm_Chr5g0033551 RchiOBHm_Chr6g0284031
rosa_laevigata	RLG00000030479 RLG00000031213
rosa_multiflora	Rmu_co8312939.1_g000001 Rmu_co8353809.1_g000001 Rmu_sc0002206.1_g000013 Rmu_sc0002206.1_g000041 Rmu_sc0003102.1_g000002 Rmu_sc0005660.1_g000007 Rmu_sc0032629.1_g000002
rosa_roxburghii	Rroxscaffold_1G00046580 Rroxscaffold_1G00071400 Rroxscaffold_1G00071700 Rroxscaffold_1G00071740 Rroxscaffold_7G00169640 Rroxscaffold_7G00185010
rosa_rugosa	Rorug06G0159700
rosa_samantha	Rh5AG230700 Rh5AG230900 Rh5AG231400 Rh5AG233700 Rh5BG234200 Rh6BG404100 Rh6BG404200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	144
AfaI	GTAC	1 cut(s)	111
AluBI	AGCT	1 cut(s)	47
AluI	AGCT	1 cut(s)	47
AoxI	GGCC	1 cut(s)	53
BccI	CCATC	1 cut(s)	130
BmsI	GCATC	1 cut(s)	18
Bse1I	ACTGG	1 cut(s)	107
BseGI	GGATG	1 cut(s)	9
BseMII	CTCAG	1 cut(s)	108
BseNI	ACTGG	1 cut(s)	107
BshFI	GGCC	1 cut(s)	55
BsmI	GAATGC	1 cut(s)	70
BsnI	GGCC	1 cut(s)	55
BspANI	GGCC	1 cut(s)	55
BspCNI	CTCAG	1 cut(s)	107
BsrI	ACTGG	1 cut(s)	107
Bst4CI	ACNGT	1 cut(s)	89
BstDEI	CTNAG	1 cut(s)	94
BstF5I	GGATG	1 cut(s)	9
BstMWI	GCNNNNNNNGC	1 cut(s)	31
BsuRI	GGCC	1 cut(s)	55
BtsCI	GGATG	1 cut(s)	9
Csp6I	GTAC	1 cut(s)	110
CviAII	CATG	2 cut(s)	61, 157
CviJI	RGCY	2 cut(s)	47, 55
CviKI_1	RGCY	2 cut(s)	47, 55
CviQI	GTAC	1 cut(s)	110
DdeI	CTNAG	1 cut(s)	94
EcoT22I	ATGCAT	1 cut(s)	11
FaeI	CATG	2 cut(s)	64, 160
FaiI	YATR	5 cut(s)	15, 28, 44, 62, 158
FatI	CATG	2 cut(s)	60, 156
HaeIII	GGCC	1 cut(s)	55
Hin1II	CATG	2 cut(s)	64, 160
Hpy188I	TCNGA	1 cut(s)	134
HpyCH4III	ACNGT	1 cut(s)	89
HpyCH4IV	ACGT	1 cut(s)	144
HpyCH4V	TGCA	2 cut(s)	9, 34
HpyF10VI	GCNNNNNNNGC	1 cut(s)	31
HpyF3I	CTNAG	1 cut(s)	94
HpySE526I	ACGT	1 cut(s)	144
Hsp92II	CATG	2 cut(s)	64, 160
LpnPI	CCDG	1 cut(s)	120
LweI	GCATC	1 cut(s)	18
MaeII	ACGT	1 cut(s)	144
MaeIII	GTNAC	3 cut(s)	89, 97, 140
MmeI	TCCRAC	1 cut(s)	127
MnlI	CCTC	1 cut(s)	124
Mph1103I	ATGCAT	1 cut(s)	11
MseI	TTAA	1 cut(s)	84
Mva1269I	GAATGC	1 cut(s)	70
MwoI	GCNNNNNNNGC	1 cut(s)	31
NlaIII	CATG	2 cut(s)	64, 160
NmuCI	GTSAC	1 cut(s)	97
NsiI	ATGCAT	1 cut(s)	11
PctI	GAATGC	1 cut(s)	70
Psp1406I	AACGTT	1 cut(s)	144
RsaI	GTAC	1 cut(s)	111
RsaNI	GTAC	1 cut(s)	110
SaqAI	TTAA	1 cut(s)	84
SetI	ASST	2 cut(s)	49, 147
SfaNI	GCATC	1 cut(s)	18
SgeI	CNNG	3 cut(s)	47, 73, 119
TaaI	ACNGT	1 cut(s)	89
TaiI	ACGT	1 cut(s)	147
Tru1I	TTAA	1 cut(s)	84
Tru9I	TTAA	1 cut(s)	84
TseFI	GTSAC	1 cut(s)	97
Tsp45I	GTSAC	1 cut(s)	97
TspDTI	ATGAA	1 cut(s)	77
Zsp2I	ATGCAT	1 cut(s)	11

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.