Rmu_co8312939.1_g000001

Cysteine-rich receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8312939.1
Physical Location & Seq
Reverse (-)
1 .. 442
442 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8312939.1_g000001.1.cds

Sequence Viewer

Length: 240 bp
atgttggctttgcttgctgcttggttagcgaggcttgcacactcgaacactggacttccttggacaatccttgctgcccttcgacactcgagatatatggctccagagtatgtcatgcgtggacagttttctgtcaagtctgatgcctatagctccggtgtgttagttctggagatagtgagtggacagaaaaacagttctttcagtcatgaagggaatgtggaagatcttctaagctat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.83

Weight (kDa)

6.82

Isoelectric Point (pI)

32.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 153, 237
AluI AGCT 2 cut(s) 153, 237
Ama87I CYCGRG 1 cut(s) 88
ApeKI GCWGC 2 cut(s) 17, 74
Asp700I GAANNNNTTC 1 cut(s) 228
AvaI CYCGRG 1 cut(s) 88
BbvI GCAGC 2 cut(s) 4, 61
BfmI CTRYAG 1 cut(s) 148
BglII AGATCT 1 cut(s) 226
BisI GCNGC 2 cut(s) 18, 75
BlsI GCNGC 2 cut(s) 19, 76
BmeT110I CYCGRG 1 cut(s) 88
BmiI GGNNCC 1 cut(s) 102
BmsI GCATC 1 cut(s) 133
BpmI CTGGAG 2 cut(s) 87, 191
BsaJI CCNNGG 1 cut(s) 59
BsaWI WCCGGW 1 cut(s) 155
Bse1I ACTGG 1 cut(s) 55
BseDI CCNNGG 1 cut(s) 59
BseNI ACTGG 1 cut(s) 55
BseXI GCAGC 2 cut(s) 4, 61
BsiHKCI CYCGRG 1 cut(s) 88
BsiSI CCGG 1 cut(s) 156
BsoBI CYCGRG 1 cut(s) 88
Bsp143I GATC 1 cut(s) 226
BspHI TCATGA 1 cut(s) 208
BspLI GGNNCC 1 cut(s) 102
BsrI ACTGG 1 cut(s) 55
BssECI CCNNGG 1 cut(s) 59
BssMI GATC 1 cut(s) 226
BssT1I CCWWGG 1 cut(s) 59
Bst4CI ACNGT 2 cut(s) 126, 197
BstC8I GCNNGC 2 cut(s) 15, 36
BstDEI CTNAG 1 cut(s) 233
BstKTI GATC 1 cut(s) 229
BstMBI GATC 1 cut(s) 226
BstMWI GCNNNNNNNGC 3 cut(s) 14, 26, 35
BstSFI CTRYAG 1 cut(s) 148
BstV1I GCAGC 2 cut(s) 4, 61
BstX2I RGATCY 1 cut(s) 226
BstYI RGATCY 1 cut(s) 226
BtsIMutI CAGTG 1 cut(s) 48
Cac8I GCNNGC 2 cut(s) 15, 36
CciI TCATGA 1 cut(s) 208
CviAII CATG 2 cut(s) 115, 209
CviJI RGCY 5 cut(s) 8, 34, 101, 153, 237
CviKI_1 RGCY 5 cut(s) 8, 34, 101, 153, 237
DdeI CTNAG 1 cut(s) 233
DpnI GATC 1 cut(s) 228
DpnII GATC 1 cut(s) 226
Eco130I CCWWGG 1 cut(s) 59
Eco88I CYCGRG 1 cut(s) 88
EcoT14I CCWWGG 1 cut(s) 59
ErhI CCWWGG 1 cut(s) 59
FaeI CATG 2 cut(s) 118, 212
FaiI YATR 6 cut(s) 96, 98, 111, 116, 150, 210
FatI CATG 2 cut(s) 114, 208
Fnu4HI GCNGC 2 cut(s) 18, 75
Fsp4HI GCNGC 2 cut(s) 18, 75
GluI GCNGC 2 cut(s) 18, 75
GsuI CTGGAG 2 cut(s) 87, 191
HapII CCGG 1 cut(s) 156
Hin1II CATG 2 cut(s) 118, 212
HpaII CCGG 1 cut(s) 156
Hpy166II GTNNAC 2 cut(s) 122, 185
Hpy188I TCNGA 1 cut(s) 142
Hpy188III TCNNGA 4 cut(s) 90, 104, 170, 209
Hpy8I GTNNAC 2 cut(s) 122, 185
HpyAV CCTTC 2 cut(s) 89, 206
HpyCH4III ACNGT 2 cut(s) 126, 197
HpyCH4V TGCA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 3 cut(s) 14, 26, 35
HpyF3I CTNAG 1 cut(s) 233
Hsp92II CATG 2 cut(s) 118, 212
Kzo9I GATC 1 cut(s) 226
LmnI GCTCC 2 cut(s) 106, 158
LpnPI CCDG 4 cut(s) 36, 117, 155, 169
Lsp1109I GCAGC 2 cut(s) 4, 61
LweI GCATC 1 cut(s) 133
MalI GATC 1 cut(s) 228
MboI GATC 1 cut(s) 226
MboII GAAGA 2 cut(s) 221, 236
MflI RGATCY 1 cut(s) 226
MnlI CCTC 1 cut(s) 24
MroXI GAANNNNTTC 1 cut(s) 228
MspI CCGG 1 cut(s) 156
MwoI GCNNNNNNNGC 3 cut(s) 14, 26, 35
NdeII GATC 1 cut(s) 226
NlaIII CATG 2 cut(s) 118, 212
NlaIV GGNNCC 1 cut(s) 102
PaeR7I CTCGAG 1 cut(s) 88
PagI TCATGA 1 cut(s) 208
PdmI GAANNNNTTC 1 cut(s) 228
PkrI GCNGC 2 cut(s) 19, 76
PspN4I GGNNCC 1 cut(s) 102
PsuI RGATCY 1 cut(s) 226
SatI GCNGC 2 cut(s) 18, 75
Sau3AI GATC 1 cut(s) 226
SetI ASST 2 cut(s) 155, 239
SfaNI GCATC 1 cut(s) 133
SfcI CTRYAG 1 cut(s) 148
Sfr274I CTCGAG 1 cut(s) 88
SlaI CTCGAG 1 cut(s) 88
SmlI CTYRAG 1 cut(s) 88
SmoI CTYRAG 1 cut(s) 88
StyI CCWWGG 1 cut(s) 59
TaaI ACNGT 2 cut(s) 126, 197
TaqI TCGA 3 cut(s) 44, 82, 89
TscAI CASTG 1 cut(s) 55
TseI GCWGC 2 cut(s) 17, 74
TspDTI ATGAA 1 cut(s) 225
TspRI CASTG 1 cut(s) 55
XhoI CTCGAG 1 cut(s) 88
XmnI GAANNNNTTC 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.