Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8353809.1

Orthogroup ID

OG0002863

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 465

Gene Structure 465 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8353809.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 240 bp

atgaatcctaaaattgcagattttggcatggcaagattatttctgatggatcaaactcaaggacacacaaacagagtcgtagggacctatggatacatggctccagagtatgccatccatgggcgtttttctgtcaaatcggatgtcttcagttttggtgtgttagttcttgagattgtgagtggcaagaaagtgagcacttttcggaatggtgagaatgaagaggaccttctcagctat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr Stress-antifung

Protein Analysis

80

Amino Acids

8.98

Weight (kDa)

6.04

Isoelectric Point (pI)

20.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002863)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g02801
malus_domestica	MD05G1337200.v1.1 MD07G1013600.v1.1 MD07G1013800.v1.1 MD14G1206900.v1.1
prunus_persica	Prupe.4G028300_v2.0.a1
pyrus_communis	pycom08g11830 pycom10g26440 pycom11g01830
rosa_chinensis	RchiOBHm_Chr2g0114621 RchiOBHm_Chr2g0114771 RchiOBHm_Chr2g0114811 RchiOBHm_Chr5g0033421 RchiOBHm_Chr5g0033511 RchiOBHm_Chr5g0033551 RchiOBHm_Chr6g0284031
rosa_laevigata	RLG00000030479 RLG00000031213
rosa_multiflora	Rmu_co8312939.1_g000001 Rmu_co8353809.1_g000001 Rmu_sc0002206.1_g000013 Rmu_sc0002206.1_g000041 Rmu_sc0003102.1_g000002 Rmu_sc0005660.1_g000007 Rmu_sc0032629.1_g000002
rosa_roxburghii	Rroxscaffold_1G00046580 Rroxscaffold_1G00071400 Rroxscaffold_1G00071700 Rroxscaffold_1G00071740 Rroxscaffold_7G00169640 Rroxscaffold_7G00185010
rosa_rugosa	Rorug06G0159700
rosa_samantha	Rh5AG230700 Rh5AG230900 Rh5AG231400 Rh5AG233700 Rh5BG234200 Rh6BG404100 Rh6BG404200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	57
AcuI	CTGAAG	1 cut(s)	133
AfiI	CCNNNNNNNGG	1 cut(s)	120
AluBI	AGCT	1 cut(s)	237
AluI	AGCT	1 cut(s)	237
Alw21I	GWGCWC	1 cut(s)	200
AlwI	GGATC	1 cut(s)	57
ArsI	GACNNNNNNTTYG	2 cut(s)	129, 161
AspS9I	GGNCC	2 cut(s)	84, 226
AsuHPI	GGTGA	1 cut(s)	224
AvaII	GGWCC	2 cut(s)	84, 226
BbsI	GAAGAC	1 cut(s)	139
Bbv12I	GWGCWC	1 cut(s)	200
BccI	CCATC	2 cut(s)	40, 122
BciVI	GTATCC	1 cut(s)	86
BfuI	GTATCC	1 cut(s)	86
Bme18I	GGWCC	2 cut(s)	84, 226
BmgT120I	GGNCC	2 cut(s)	84, 226
BmiI	GGNNCC	2 cut(s)	85, 102
BpiI	GAAGAC	1 cut(s)	139
BpmI	CTGGAG	1 cut(s)	87
BpuEI	CTTGAG	2 cut(s)	42, 191
BsaJI	CCNNGG	1 cut(s)	118
Bsc4I	CCNNNNNNNGG	1 cut(s)	120
BseDI	CCNNGG	1 cut(s)	118
BseGI	GGATG	2 cut(s)	114, 148
BseLI	CCNNNNNNNGG	1 cut(s)	120
BsiHKAI	GWGCWC	1 cut(s)	200
BslFI	GGGAC	1 cut(s)	97
BslI	CCNNNNNNNGG	1 cut(s)	120
BsmFI	GGGAC	1 cut(s)	97
Bsp1286I	GDGCHC	1 cut(s)	200
Bsp143I	GATC	1 cut(s)	49
Bsp19I	CCATGG	1 cut(s)	118
BspLI	GGNNCC	2 cut(s)	85, 102
BspPI	GGATC	1 cut(s)	57
BssECI	CCNNGG	1 cut(s)	118
BssMI	GATC	1 cut(s)	49
BssT1I	CCWWGG	1 cut(s)	118
Bst6I	CTCTTC	1 cut(s)	216
BstDEI	CTNAG	1 cut(s)	233
BstDSI	CCRYGG	1 cut(s)	118
BstF5I	GGATG	2 cut(s)	114, 148
BstKTI	GATC	1 cut(s)	52
BstMBI	GATC	1 cut(s)	49
BstV2I	GAAGAC	1 cut(s)	139
BsuI	GTATCC	1 cut(s)	86
BtgI	CCRYGG	1 cut(s)	118
BtsCI	GGATG	2 cut(s)	114, 148
Cfr13I	GGNCC	2 cut(s)	84, 226
CviAII	CATG	3 cut(s)	28, 97, 119
CviJI	RGCY	2 cut(s)	101, 237
CviKI_1	RGCY	2 cut(s)	101, 237
DdeI	CTNAG	1 cut(s)	233
DpnI	GATC	1 cut(s)	51
DpnII	GATC	1 cut(s)	49
Eam1104I	CTCTTC	1 cut(s)	216
EarI	CTCTTC	1 cut(s)	216
Eco130I	CCWWGG	1 cut(s)	118
Eco47I	GGWCC	2 cut(s)	84, 226
Eco57I	CTGAAG	1 cut(s)	133
EcoO109I	RGGNCCY	2 cut(s)	84, 226
EcoT14I	CCWWGG	1 cut(s)	118
ErhI	CCWWGG	1 cut(s)	118
FaeI	CATG	3 cut(s)	31, 100, 122
FaiI	YATR	5 cut(s)	29, 90, 98, 111, 120
FalI	AAGNNNNNCTT	1 cut(s)	213
FaqI	GGGAC	1 cut(s)	97
FatI	CATG	3 cut(s)	27, 96, 118
FokI	GGATG	2 cut(s)	101, 155
GsuI	CTGGAG	1 cut(s)	87
Hin1II	CATG	3 cut(s)	31, 100, 122
HinfI	GANTC	2 cut(s)	4, 75
HphI	GGTGA	1 cut(s)	224
Hpy188I	TCNGA	3 cut(s)	45, 142, 207
Hpy188III	TCNNGA	2 cut(s)	104, 170
HpyAV	CCTTC	1 cut(s)	239
HpyCH4V	TGCA	1 cut(s)	17
HpyF3I	CTNAG	1 cut(s)	233
Hsp92II	CATG	3 cut(s)	31, 100, 122
Kzo9I	GATC	1 cut(s)	49
LmnI	GCTCC	1 cut(s)	106
LpnPI	CCDG	1 cut(s)	117
MalI	GATC	1 cut(s)	51
MboI	GATC	1 cut(s)	49
MboII	GAAGA	2 cut(s)	139, 233
MhlI	GDGCHC	1 cut(s)	200
MluCI	AATT	1 cut(s)	12
MlyI	GAGTC	1 cut(s)	84
MnlI	CCTC	1 cut(s)	217
NcoI	CCATGG	1 cut(s)	118
NdeII	GATC	1 cut(s)	49
NlaIII	CATG	3 cut(s)	31, 100, 122
NlaIV	GGNNCC	2 cut(s)	85, 102
PfeI	GAWTC	1 cut(s)	4
PleI	GAGTC	1 cut(s)	83
PpsI	GAGTC	1 cut(s)	83
PpuMI	RGGWCCY	2 cut(s)	84, 226
Psp5II	RGGWCCY	2 cut(s)	84, 226
PspN4I	GGNNCC	2 cut(s)	85, 102
PspPI	GGNCC	2 cut(s)	84, 226
PspPPI	RGGWCCY	2 cut(s)	84, 226
Sau3AI	GATC	1 cut(s)	49
Sau96I	GGNCC	2 cut(s)	84, 226
SchI	GAGTC	1 cut(s)	84
SduI	GDGCHC	1 cut(s)	200
SetI	ASST	3 cut(s)	89, 231, 239
SgeI	CNNG	8 cut(s)	40, 45, 71, 109, 116, 131, 182, 199
SinI	GGWCC	2 cut(s)	84, 226
SmlI	CTYRAG	2 cut(s)	57, 170
SmoI	CTYRAG	2 cut(s)	57, 170
Sse9I	AATT	1 cut(s)	12
StyI	CCWWGG	1 cut(s)	118
TasI	AATT	1 cut(s)	12
TfiI	GAWTC	1 cut(s)	4
TspDTI	ATGAA	2 cut(s)	17, 234
VpaK11BI	GGWCC	2 cut(s)	84, 226

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.