RchiOBHm_Chr5g0033511

Cysteine-rich receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
27352209 .. 27352739
531 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31258

Sequence Viewer

Length: 486 bp
ATGTTAGTTCTTGAGATAGTTAGTGGTAAGAAGATTGGTATTTTCCGCAATGGTGAAAATGGAGAGGACTTTCTAAGCTATGTCAATAAGAATATACAATCAAGTCATTACATTAAATCTCCATATATTTCTCTCTTAAGCCCACAACAGAGAAACCGAATAGGTAAAGTCGTCTGGAAAAATTGGAGGGATGATACAATTCCAAATATCATAGATCCCATGTTGACAATAGGTTCAAGAAAAAAAATGATCAGATGCATCCACATTGGTTTGCTATGTGTCCAAGAAAATGTGAATGACAGACCAACCATGTCTTCAGATGTTTCCATGCTTAACAATCATTCTCTCACAATCTCAATACCATCCAAACCTGCATATTATTCGCAATACAACTCTGAATCAGACATAGACAAGTCTACATCTGAAAGCTTTATGTATGTGTCAAAAAATGTTGTTTCAAATATTATTGAACCATACCCACGCTAG

Protein Analysis

161

Amino Acids

18.4

Weight (kDa)

9.06

Isoelectric Point (pI)

54.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 379
AccI GTMKAC 1 cut(s) 416
AciI CCGC 1 cut(s) 46
AclWI GGATC 1 cut(s) 209
AcuI CTGAAG 1 cut(s) 300
AflII CTTAAG 1 cut(s) 136
AgsI TTSAA 3 cut(s) 237, 459, 470
AjuI GAANNNNNNNTTGG 2 cut(s) 298, 330
AluBI AGCT 2 cut(s) 78, 429
AluI AGCT 2 cut(s) 78, 429
AlwI GGATC 1 cut(s) 209
AsuHPI GGTGA 1 cut(s) 65
BbsI GAAGAC 1 cut(s) 306
BccI CCATC 1 cut(s) 370
BcgI CGANNNNNNTGC 2 cut(s) 363, 397
BclI TGATCA 1 cut(s) 249
BfaI CTAG 1 cut(s) 484
BfrI CTTAAG 1 cut(s) 136
BfuAI ACCTGC 1 cut(s) 379
BmsI GCATC 2 cut(s) 245, 267
BpiI GAAGAC 1 cut(s) 306
BpuEI CTTGAG 1 cut(s) 32
Bse3DI GCAATG 1 cut(s) 55
BseGI GGATG 3 cut(s) 196, 258, 362
BseMI GCAATG 1 cut(s) 55
Bsp143I GATC 2 cut(s) 214, 249
BspACI CCGC 1 cut(s) 46
BspMI ACCTGC 1 cut(s) 379
BspPI GGATC 1 cut(s) 209
BspTI CTTAAG 1 cut(s) 136
BsrDI GCAATG 1 cut(s) 55
BssMI GATC 2 cut(s) 214, 249
BstAFI CTTAAG 1 cut(s) 136
BstDEI CTNAG 1 cut(s) 74
BstF5I GGATG 3 cut(s) 196, 258, 362
BstKTI GATC 2 cut(s) 217, 252
BstMBI GATC 2 cut(s) 214, 249
BstV2I GAAGAC 1 cut(s) 306
BstX2I RGATCY 1 cut(s) 214
BstYI RGATCY 1 cut(s) 214
BtsCI GGATG 3 cut(s) 196, 258, 362
BveI ACCTGC 1 cut(s) 379
CviAII CATG 3 cut(s) 220, 310, 328
CviJI RGCY 3 cut(s) 78, 141, 429
CviKI_1 RGCY 3 cut(s) 78, 141, 429
DdeI CTNAG 1 cut(s) 74
DpnI GATC 2 cut(s) 216, 251
DpnII GATC 2 cut(s) 214, 249
Eco57I CTGAAG 1 cut(s) 300
EcoT22I ATGCAT 1 cut(s) 260
FaeI CATG 3 cut(s) 223, 313, 331
FatI CATG 3 cut(s) 219, 309, 327
FbaI TGATCA 1 cut(s) 249
FblI GTMKAC 1 cut(s) 416
FokI GGATG 3 cut(s) 203, 245, 349
FspBI CTAG 1 cut(s) 484
Hin1II CATG 3 cut(s) 223, 313, 331
HincII GTYRAC 1 cut(s) 225
HindII GTYRAC 1 cut(s) 225
HindIII AAGCTT 1 cut(s) 427
HinfI GANTC 1 cut(s) 398
HphI GGTGA 1 cut(s) 65
Hpy166II GTNNAC 2 cut(s) 225, 417
Hpy188I TCNGA 5 cut(s) 254, 319, 397, 403, 424
Hpy188III TCNNGA 3 cut(s) 11, 175, 237
Hpy8I GTNNAC 2 cut(s) 225, 417
HpyCH4V TGCA 2 cut(s) 258, 374
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 3 cut(s) 223, 313, 331
Ksp22I TGATCA 1 cut(s) 249
Kzo9I GATC 2 cut(s) 214, 249
LpnPI CCDG 2 cut(s) 160, 384
LweI GCATC 2 cut(s) 245, 267
MaeI CTAG 1 cut(s) 484
MalI GATC 2 cut(s) 216, 251
MboI GATC 2 cut(s) 214, 249
MboII GAAGA 2 cut(s) 43, 306
MflI RGATCY 1 cut(s) 214
MluCI AATT 2 cut(s) 181, 198
MnlI CCTC 2 cut(s) 58, 180
Mph1103I ATGCAT 1 cut(s) 260
MseI TTAA 3 cut(s) 114, 137, 333
MspCI CTTAAG 1 cut(s) 136
NdeII GATC 2 cut(s) 214, 249
NlaIII CATG 3 cut(s) 223, 313, 331
NsiI ATGCAT 1 cut(s) 260
PfeI GAWTC 1 cut(s) 398
PsuI RGATCY 1 cut(s) 214
SaqAI TTAA 3 cut(s) 114, 137, 333
Sau3AI GATC 2 cut(s) 214, 249
SetI ASST 5 cut(s) 80, 166, 235, 373, 431
SfaNI GCATC 2 cut(s) 245, 267
SmlI CTYRAG 2 cut(s) 11, 136
SmoI CTYRAG 2 cut(s) 11, 136
Sse9I AATT 2 cut(s) 181, 198
SsiI CCGC 1 cut(s) 46
SspI AATATT 1 cut(s) 463
SspMI CTAG 1 cut(s) 484
TasI AATT 2 cut(s) 181, 198
TfiI GAWTC 1 cut(s) 398
Tru1I TTAA 3 cut(s) 114, 137, 333
Tru9I TTAA 3 cut(s) 114, 137, 333
Vha464I CTTAAG 1 cut(s) 136
XmiI GTMKAC 1 cut(s) 416
XspI CTAG 1 cut(s) 484
Zsp2I ATGCAT 1 cut(s) 260
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.