Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr05

Orthogroup ID

OG0004212

Physical Location & Seq

Genomic Coordinates Reverse (-)

46247022 .. 46247368

Gene Structure 347 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD05G1342000.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 279 bp

ATGTGGATGTCAGAGCCTGGAAGTTCTAGTGATGAGGGTTCTTCTAGCTTTAGCTCTAAGTCTGAGTCTGCAATGTCGGAGTCTTCAGGGTCTTTGTTAGAGTCCTGTACTAGAGAAACATTGGATGATCTTCCCAACCGTCGAACTTTAGCTATTGCTAGTTCTTCCTCCATGGCGTTGGGTGAGGGGGTTTCTCCTGATATGTCTTTGCCTCGACGGAGGCATGGTTATAAGCCTGCGCCATCACCTCAGAGTAAGTCTTCCAAGTATTGGCATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 zf-RVT

Protein Analysis

93

Amino Acids

9.9

Weight (kDa)

6.07

Isoelectric Point (pI)

114.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004212)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g00910 FvH4_2g19120
malus_domestica	MD00G1026400.v1.1 MD05G1342000.v1.1
rosa_chinensis	RchiOBHm_Chr1g0325301 RchiOBHm_Chr6g0267261
rosa_laevigata	RLG00000002306 RLG00000008304 RLG00000008305 RLG00000023168 RLG00000023169 RLG00000034344 RLG00000034345
rosa_multiflora	Rmu_sc0000226.1_g000007 Rmu_sc0002280.1_g000010 Rmu_sc0002724.1_g000006 Rmu_sc0003945.1_g000015 Rmu_sc0005665.1_g000015 Rmu_sc0015523.1_g000014
rosa_roxburghii	Rroxscaffold_2G00155190 Rroxscaffold_2G00155200 Rroxscaffold_2G00155210 Rroxscaffold_2G00155220 Rroxscaffold_3G00238450 Rroxscaffold_3G00238460 Rroxscaffold_4G00318960 Rroxscaffold_4G00318980 Rroxscaffold_7G00215260
rosa_samantha	Rh1DG282300 Rh2DG050600 Rh3AG252200 Rh7AG090900 Rh7AG425200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	231
AccB7I	CCANNNNNTGG	1 cut(s)	270
AcuI	CTGAAG	1 cut(s)	69
AfaI	GTAC	1 cut(s)	109
AfiI	CCNNNNNNNGG	1 cut(s)	270
AjnI	CCWGG	1 cut(s)	16
AluBI	AGCT	3 cut(s)	48, 54, 152
AluI	AGCT	3 cut(s)	48, 54, 152
AlwNI	CAGNNNCTG	1 cut(s)	17
AspLEI	GCGC	1 cut(s)	241
AsuHPI	GGTGA	2 cut(s)	194, 237
BbsI	GAAGAC	2 cut(s)	75, 252
BccI	CCATC	1 cut(s)	250
BciT130I	CCWGG	1 cut(s)	18
BfaI	CTAG	4 cut(s)	27, 45, 111, 159
Bme1390I	CCNGG	1 cut(s)	18
BmrFI	CCNGG	1 cut(s)	18
BpiI	GAAGAC	2 cut(s)	75, 252
BsaJI	CCNNGG	1 cut(s)	171
BsaXI	ACNNNNNCTCC	2 cut(s)	211, 241
Bsc4I	CCNNNNNNNGG	1 cut(s)	270
Bse3DI	GCAATG	1 cut(s)	78
BseBI	CCWGG	1 cut(s)	18
BseDI	CCNNGG	1 cut(s)	171
BseGI	GGATG	2 cut(s)	12, 130
BseLI	CCNNNNNNNGG	1 cut(s)	270
BseMI	GCAATG	1 cut(s)	78
BseMII	CTCAG	2 cut(s)	54, 263
BslI	CCNNNNNNNGG	1 cut(s)	270
Bsp143I	GATC	1 cut(s)	127
Bsp19I	CCATGG	1 cut(s)	171
BspCNI	CTCAG	2 cut(s)	55, 262
BsrDI	GCAATG	1 cut(s)	78
BssECI	CCNNGG	1 cut(s)	171
BssMI	GATC	1 cut(s)	127
BssT1I	CCWWGG	1 cut(s)	171
Bst2UI	CCWGG	1 cut(s)	18
Bst4CI	ACNGT	1 cut(s)	140
BstC8I	GCNNGC	1 cut(s)	237
BstDEI	CTNAG	3 cut(s)	57, 63, 249
BstDSI	CCRYGG	1 cut(s)	171
BstF5I	GGATG	2 cut(s)	12, 130
BstHHI	GCGC	1 cut(s)	241
BstKTI	GATC	1 cut(s)	130
BstMBI	GATC	1 cut(s)	127
BstNI	CCWGG	1 cut(s)	18
BstSCI	CCNGG	1 cut(s)	16
BstV2I	GAAGAC	2 cut(s)	75, 252
BstXI	CCANNNNNNTGG	1 cut(s)	178
BtgI	CCRYGG	1 cut(s)	171
BtsCI	GGATG	2 cut(s)	12, 130
Cac8I	GCNNGC	1 cut(s)	237
CaiI	CAGNNNCTG	1 cut(s)	17
CfoI	GCGC	1 cut(s)	241
Csp6I	GTAC	1 cut(s)	108
CviAII	CATG	2 cut(s)	172, 224
CviJI	RGCY	5 cut(s)	16, 48, 54, 152, 235
CviKI_1	RGCY	5 cut(s)	16, 48, 54, 152, 235
CviQI	GTAC	1 cut(s)	108
DdeI	CTNAG	3 cut(s)	57, 63, 249
DpnI	GATC	1 cut(s)	129
DpnII	GATC	1 cut(s)	127
Eco130I	CCWWGG	1 cut(s)	171
Eco57I	CTGAAG	1 cut(s)	69
EcoRII	CCWGG	1 cut(s)	16
EcoT14I	CCWWGG	1 cut(s)	171
ErhI	CCWWGG	1 cut(s)	171
FaeI	CATG	2 cut(s)	175, 227
FaiI	YATR	4 cut(s)	173, 203, 225, 231
FatI	CATG	2 cut(s)	171, 223
FokI	GGATG	2 cut(s)	19, 137
FspBI	CTAG	4 cut(s)	27, 45, 111, 159
GlaI	GCGC	1 cut(s)	240
HhaI	GCGC	1 cut(s)	241
Hin1II	CATG	2 cut(s)	175, 227
Hin6I	GCGC	1 cut(s)	239
HinP1I	GCGC	1 cut(s)	239
HinfI	GANTC	3 cut(s)	65, 80, 101
HphI	GGTGA	2 cut(s)	194, 237
Hpy188I	TCNGA	4 cut(s)	13, 64, 79, 252
Hpy188III	TCNNGA	1 cut(s)	197
Hpy99I	CGWCG	2 cut(s)	144, 219
HpyCH4III	ACNGT	1 cut(s)	140
HpyCH4V	TGCA	1 cut(s)	71
HpyF3I	CTNAG	3 cut(s)	57, 63, 249
Hsp92II	CATG	2 cut(s)	175, 227
HspAI	GCGC	1 cut(s)	239
Kzo9I	GATC	1 cut(s)	127
LpnPI	CCDG	6 cut(s)	3, 30, 72, 118, 210, 249
MaeI	CTAG	4 cut(s)	27, 45, 111, 159
MalI	GATC	1 cut(s)	129
MboI	GATC	1 cut(s)	127
MboII	GAAGA	5 cut(s)	33, 75, 122, 156, 252
MlyI	GAGTC	3 cut(s)	74, 89, 110
MmeI	TCCRAC	1 cut(s)	57
MnlI	CCTC	6 cut(s)	28, 178, 178, 213, 222, 258
MspR9I	CCNGG	1 cut(s)	18
MvaI	CCWGG	1 cut(s)	18
NcoI	CCATGG	1 cut(s)	171
NdeII	GATC	1 cut(s)	127
NlaIII	CATG	2 cut(s)	175, 227
PflMI	CCANNNNNTGG	1 cut(s)	270
PleI	GAGTC	3 cut(s)	73, 88, 109
PpsI	GAGTC	3 cut(s)	73, 88, 109
PsiI	TTATAA	1 cut(s)	231
Psp6I	CCWGG	1 cut(s)	16
PspGI	CCWGG	1 cut(s)	16
PstNI	CAGNNNCTG	1 cut(s)	17
RsaI	GTAC	1 cut(s)	109
RsaNI	GTAC	1 cut(s)	108
Sau3AI	GATC	1 cut(s)	127
SchI	GAGTC	3 cut(s)	74, 89, 110
ScrFI	CCNGG	1 cut(s)	18
SetI	ASST	4 cut(s)	50, 56, 154, 250
SspMI	CTAG	4 cut(s)	27, 45, 111, 159
StyD4I	CCNGG	1 cut(s)	16
StyI	CCWWGG	1 cut(s)	171
TaaI	ACNGT	1 cut(s)	140
TaqI	TCGA	2 cut(s)	142, 214
TatI	WGTACW	1 cut(s)	107
TspGWI	ACGGA	1 cut(s)	232
Van91I	CCANNNNNTGG	1 cut(s)	270
XspI	CTAG	4 cut(s)	27, 45, 111, 159

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.