Rroxscaffold_3G00238450

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
26631743 .. 26640302
8560 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00238450.1

Sequence Viewer

Length: 267 bp
ATGGGGCTCATTGACACTAAGACTTGTACCGCAAATTTTGGGACAGGTGAACTCGAGGGGGAACTTGATTCTCTTGTGGAAGGGGCTAAAAGTTCTTTGATTTTGGCCAATTTAAAGAATCATCTCATAATTGACAAGATGGCGGAGAGGATTCATGGAGATGAGAATGGAGGCTTGGCGTTTGGATTCTTGAAGCTTGGAAGCAAGTCTTCAAGGTGGAGGATGGATGATGATGAAACGTTGCTTGAAACGTTGAAAATGCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.65

Weight (kDa)

5.04

Isoelectric Point (pI)

33.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 30, 143
AclI AACGTT 2 cut(s) 239, 251
AcoI YGGCCR 1 cut(s) 105
AcsI RAATTY 1 cut(s) 34
AfaI GTAC 1 cut(s) 28
AgsI TTSAA 4 cut(s) 193, 213, 248, 256
AjuI GAANNNNNNNTTGG 2 cut(s) 158, 190
AluBI AGCT 1 cut(s) 196
AluI AGCT 1 cut(s) 196
Ama87I CYCGRG 1 cut(s) 53
AoxI GGCC 1 cut(s) 105
ApoI RAATTY 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 59
AvaI CYCGRG 1 cut(s) 53
BalI TGGCCA 1 cut(s) 107
BanII GRGCYC 1 cut(s) 9
BbsI GAAGAC 1 cut(s) 201
BccI CCATC 2 cut(s) 133, 217
BfaI CTAG 1 cut(s) 265
BmeT110I CYCGRG 1 cut(s) 53
BpiI GAAGAC 1 cut(s) 201
BseGI GGATG 2 cut(s) 228, 232
BshFI GGCC 1 cut(s) 107
BsiHKCI CYCGRG 1 cut(s) 53
BslFI GGGAC 1 cut(s) 55
BsmFI GGGAC 1 cut(s) 55
BsnI GGCC 1 cut(s) 107
BsoBI CYCGRG 1 cut(s) 53
Bsp1286I GDGCHC 1 cut(s) 9
BspACI CCGC 2 cut(s) 30, 143
BspANI GGCC 1 cut(s) 107
BstDEI CTNAG 1 cut(s) 18
BstF5I GGATG 2 cut(s) 228, 232
BstV2I GAAGAC 1 cut(s) 201
BsuRI GGCC 1 cut(s) 107
BtsCI GGATG 2 cut(s) 228, 232
Csp6I GTAC 1 cut(s) 27
CviAII CATG 1 cut(s) 155
CviJI RGCY 5 cut(s) 7, 86, 107, 174, 196
CviKI_1 RGCY 5 cut(s) 7, 86, 107, 174, 196
CviQI GTAC 1 cut(s) 27
DdeI CTNAG 1 cut(s) 18
DraI TTTAAA 1 cut(s) 114
EaeI YGGCCR 1 cut(s) 105
EciI GGCGGA 1 cut(s) 158
Eco24I GRGCYC 1 cut(s) 9
Eco88I CYCGRG 1 cut(s) 53
EcoT38I GRGCYC 1 cut(s) 9
FaeI CATG 1 cut(s) 158
FaiI YATR 2 cut(s) 128, 156
FalI AAGNNNNNCTT 2 cut(s) 193, 225
FaqI GGGAC 1 cut(s) 55
FatI CATG 1 cut(s) 154
FokI GGATG 2 cut(s) 235, 239
FriOI GRGCYC 1 cut(s) 9
FspBI CTAG 1 cut(s) 265
HaeIII GGCC 1 cut(s) 107
Hin1II CATG 1 cut(s) 158
HindIII AAGCTT 1 cut(s) 194
HinfI GANTC 4 cut(s) 68, 118, 151, 186
HphI GGTGA 1 cut(s) 59
Hpy166II GTNNAC 1 cut(s) 50
Hpy188III TCNNGA 1 cut(s) 190
Hpy8I GTNNAC 1 cut(s) 50
HpyAV CCTTC 1 cut(s) 74
HpyCH4IV ACGT 2 cut(s) 239, 251
HpyCH4V TGCA 1 cut(s) 262
HpyF3I CTNAG 1 cut(s) 18
HpySE526I ACGT 2 cut(s) 239, 251
Hsp92II CATG 1 cut(s) 158
LpnPI CCDG 1 cut(s) 30
MaeI CTAG 1 cut(s) 265
MaeII ACGT 2 cut(s) 239, 251
MboII GAAGA 1 cut(s) 201
MhlI GDGCHC 1 cut(s) 9
MlsI TGGCCA 1 cut(s) 107
MluCI AATT 3 cut(s) 34, 109, 129
MluNI TGGCCA 1 cut(s) 107
MnlI CCTC 4 cut(s) 49, 141, 164, 213
Mox20I TGGCCA 1 cut(s) 107
MscI TGGCCA 1 cut(s) 107
MseI TTAA 1 cut(s) 113
MslI CAYNNNNRTG 1 cut(s) 159
Msp20I TGGCCA 1 cut(s) 107
NlaIII CATG 1 cut(s) 158
PaeR7I CTCGAG 1 cut(s) 53
PfeI GAWTC 4 cut(s) 68, 118, 151, 186
Psp1406I AACGTT 2 cut(s) 239, 251
PspXI VCTCGAGB 1 cut(s) 53
RsaI GTAC 1 cut(s) 28
RsaNI GTAC 1 cut(s) 27
RseI CAYNNNNRTG 1 cut(s) 159
SaqAI TTAA 1 cut(s) 113
SduI GDGCHC 1 cut(s) 9
SetI ASST 5 cut(s) 49, 198, 218, 242, 254
Sfr274I CTCGAG 1 cut(s) 53
SlaI CTCGAG 1 cut(s) 53
SmiMI CAYNNNNRTG 1 cut(s) 159
SmlI CTYRAG 1 cut(s) 53
SmoI CTYRAG 1 cut(s) 53
Sse9I AATT 3 cut(s) 34, 109, 129
SsiI CCGC 2 cut(s) 30, 143
SspMI CTAG 1 cut(s) 265
TaiI ACGT 2 cut(s) 242, 254
TaqI TCGA 1 cut(s) 54
TasI AATT 3 cut(s) 34, 109, 129
TfiI GAWTC 4 cut(s) 68, 118, 151, 186
Tru1I TTAA 1 cut(s) 113
Tru9I TTAA 1 cut(s) 113
TspDTI ATGAA 2 cut(s) 143, 249
XapI RAATTY 1 cut(s) 34
XhoI CTCGAG 1 cut(s) 53
XspI CTAG 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.