Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003945.1

Orthogroup ID

OG0004212

Physical Location & Seq

Genomic Coordinates Reverse (-)

29676 .. 30786

Gene Structure 1111 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003945.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 927 bp

atgagggcgtgtgatgaggtcgacaatcttatggaggatgccaggagggagactcggcagtccagggctacgcagcgagttgacactccgggtgtgcgccaccgtcaagttgacgttccagaatttctttctgattatgttggggacatgatggggcttgttgacactaagacttatacagtaaattttgggacgggtgaacttgagggggaacttgattctcttgtggaaggggctaaaagttctttgattttggccaatttgaagaatcatctcataattgacaagatggcggagaggattcgtgagttggactcccaggtgcttgcaactgacaaggagctcagggcgaccaagactcagctgggtcaaaagaataaagatgtggctaagatggaggattatcacaaaaggctgaaggaaaaagaaacagaggttgatcaactgggagaaaaggttaagggcatggagaaggaactcagggttaaggccaaagagtgtaagaaaaacaaggatttggaggtggaagtccaagaccttagagagagggttgagggtctcaggagcaaggccaaggttggtcgtaacagtgtcttgagggagttccaggattctaaagaatacaaggacatcctagagaatagctactcagaggggtataccgacttgcttaatctatgcgtagagcattttggtgagaagggtgtgggatgggcagtttctttgggtgttgaagctgcgccttcagaaatcaagggtagcccttctaaggttacacttgctgatgcgagtccaggtcttaccctgtcaggtcatgaacaaggtaagtctggcattggtgacactccggctgaggacaaagggagtgctcttggagatggggaagatggggatgaaagggctaaggtgacaaatgccgatccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

308

Amino Acids

34.13

Weight (kDa)

5.1

Isoelectric Point (pI)

31.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004212)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g00910 FvH4_2g19120
malus_domestica	MD00G1026400.v1.1 MD05G1342000.v1.1
rosa_chinensis	RchiOBHm_Chr1g0325301 RchiOBHm_Chr6g0267261
rosa_laevigata	RLG00000002306 RLG00000008304 RLG00000008305 RLG00000023168 RLG00000023169 RLG00000034344 RLG00000034345
rosa_multiflora	Rmu_sc0000226.1_g000007 Rmu_sc0002280.1_g000010 Rmu_sc0002724.1_g000006 Rmu_sc0003945.1_g000015 Rmu_sc0005665.1_g000015 Rmu_sc0015523.1_g000014
rosa_roxburghii	Rroxscaffold_2G00155190 Rroxscaffold_2G00155200 Rroxscaffold_2G00155210 Rroxscaffold_2G00155220 Rroxscaffold_3G00238450 Rroxscaffold_3G00238460 Rroxscaffold_4G00318960 Rroxscaffold_4G00318980 Rroxscaffold_7G00215260
rosa_samantha	Rh1DG282300 Rh2DG050600 Rh3AG252200 Rh7AG090900 Rh7AG425200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	58
AccI	GTMKAC	2 cut(s)	21, 659
AciI	CCGC	1 cut(s)	293
AclWI	GGATC	1 cut(s)	914
AcoI	YGGCCR	1 cut(s)	255
AcsI	RAATTY	2 cut(s)	122, 184
AcuI	CTGAAG	2 cut(s)	437, 729
AfiI	CCNNNNNNNGG	1 cut(s)	769
AgsI	TTSAA	2 cut(s)	265, 734
AjnI	CCWGG	5 cut(s)	41, 62, 318, 606, 793
AluBI	AGCT	4 cut(s)	343, 364, 645, 737
AluI	AGCT	4 cut(s)	343, 364, 645, 737
Alw21I	GWGCWC	2 cut(s)	345, 871
Alw26I	GTCTC	2 cut(s)	44, 563
AlwI	GGATC	1 cut(s)	914
AoxI	GGCC	3 cut(s)	255, 489, 570
ApeKI	GCWGC	2 cut(s)	73, 737
ApoI	RAATTY	2 cut(s)	122, 184
AspLEI	GCGC	2 cut(s)	99, 742
AsuC2I	CCSGG	1 cut(s)	90
AsuHPI	GGTGA	4 cut(s)	209, 707, 851, 919
BalI	TGGCCA	1 cut(s)	257
BanII	GRGCYC	1 cut(s)	345
Bbv12I	GWGCWC	2 cut(s)	345, 871
BbvCI	CCTCAGC	1 cut(s)	852
BbvI	GCAGC	2 cut(s)	85, 724
BccI	CCATC	6 cut(s)	145, 283, 388, 705, 872, 881
BciT130I	CCWGG	5 cut(s)	43, 64, 320, 608, 795
BclI	TGATCA	1 cut(s)	439
BcnI	CCSGG	1 cut(s)	90
BcoDI	GTCTC	2 cut(s)	44, 563
BfaI	CTAG	1 cut(s)	635
BisI	GCNGC	2 cut(s)	74, 738
BlsI	GCNGC	2 cut(s)	75, 739
Bme1390I	CCNGG	6 cut(s)	43, 64, 90, 320, 608, 795
BmrFI	CCNGG	6 cut(s)	43, 64, 90, 320, 608, 795
BmrI	ACTGGG	1 cut(s)	455
BmsI	GCATC	2 cut(s)	28, 775
BmuI	ACTGGG	1 cut(s)	455
BplI	GAGNNNNNCTC	4 cut(s)	37, 69, 299, 331
Bpu10I	CCTNAGC	3 cut(s)	344, 852, 903
BpuEI	CTTGAG	2 cut(s)	224, 616
BpuMI	CCSGG	1 cut(s)	90
BsaI	GGTCTC	1 cut(s)	563
BsaJI	CCNNGG	3 cut(s)	63, 318, 573
BsaXI	ACNNNNNCTCC	2 cut(s)	441, 471
Bsc4I	CCNNNNNNNGG	1 cut(s)	769
Bse1I	ACTGG	1 cut(s)	450
BseBI	CCWGG	5 cut(s)	43, 64, 320, 608, 795
BseDI	CCNNGG	3 cut(s)	63, 318, 573
BseGI	GGATG	4 cut(s)	43, 630, 716, 898
BseLI	CCNNNNNNNGG	1 cut(s)	769
BseMII	CTCAG	6 cut(s)	358, 374, 493, 574, 663, 843
BseNI	ACTGG	1 cut(s)	450
BseXI	GCAGC	2 cut(s)	85, 724
BseYI	CCCAGC	1 cut(s)	364
BshFI	GGCC	3 cut(s)	257, 491, 572
BsiHKAI	GWGCWC	2 cut(s)	345, 871
BsiSI	CCGG	2 cut(s)	89, 848
BslFI	GGGAC	2 cut(s)	158, 205
BslI	CCNNNNNNNGG	1 cut(s)	769
BsmAI	GTCTC	2 cut(s)	44, 563
BsmFI	GGGAC	2 cut(s)	158, 205
BsnI	GGCC	3 cut(s)	257, 491, 572
Bso31I	GGTCTC	1 cut(s)	563
Bsp1286I	GDGCHC	2 cut(s)	345, 871
Bsp143I	GATC	2 cut(s)	439, 919
BspACI	CCGC	1 cut(s)	293
BspANI	GGCC	3 cut(s)	257, 491, 572
BspCNI	CTCAG	6 cut(s)	357, 373, 492, 573, 662, 844
BspHI	TCATGA	1 cut(s)	814
BspPI	GGATC	1 cut(s)	914
BspTNI	GGTCTC	1 cut(s)	563
BsrI	ACTGG	1 cut(s)	450
BssECI	CCNNGG	3 cut(s)	63, 318, 573
BssMI	GATC	2 cut(s)	439, 919
BssNAI	GTATAC	1 cut(s)	660
BssT1I	CCWWGG	1 cut(s)	573
Bst1107I	GTATAC	1 cut(s)	660
Bst2UI	CCWGG	5 cut(s)	43, 64, 320, 608, 795
Bst4CI	ACNGT	3 cut(s)	104, 181, 590
BstC8I	GCNNGC	1 cut(s)	327
BstF5I	GGATG	4 cut(s)	43, 630, 716, 898
BstHHI	GCGC	2 cut(s)	99, 742
BstKTI	GATC	2 cut(s)	442, 922
BstMAI	GTCTC	2 cut(s)	44, 563
BstMBI	GATC	2 cut(s)	439, 919
BstNI	CCWGG	5 cut(s)	43, 64, 320, 608, 795
BstSCI	CCNGG	6 cut(s)	41, 62, 88, 318, 606, 793
BstV1I	GCAGC	2 cut(s)	85, 724
BstZ17I	GTATAC	1 cut(s)	660
BsuRI	GGCC	3 cut(s)	257, 491, 572
BtsCI	GGATG	4 cut(s)	43, 630, 716, 898
BtsIMutI	CAGTG	1 cut(s)	595
Cac8I	GCNNGC	1 cut(s)	327
CciI	TCATGA	1 cut(s)	814
CfoI	GCGC	2 cut(s)	99, 742
CviAII	CATG	3 cut(s)	148, 466, 815
DpnI	GATC	2 cut(s)	441, 921
DpnII	GATC	2 cut(s)	439, 919
DrdI	GACNNNNNNGTC	1 cut(s)	58
DseDI	GACNNNNNNGTC	1 cut(s)	58
EaeI	YGGCCR	1 cut(s)	255
EciI	GGCGGA	1 cut(s)	308
Ecl136II	GAGCTC	1 cut(s)	343
Eco130I	CCWWGG	1 cut(s)	573
Eco24I	GRGCYC	1 cut(s)	345
Eco31I	GGTCTC	1 cut(s)	563
Eco53kI	GAGCTC	1 cut(s)	343
Eco57I	CTGAAG	2 cut(s)	437, 729
EcoICRI	GAGCTC	1 cut(s)	343
EcoRII	CCWGG	5 cut(s)	41, 62, 318, 606, 793
EcoT14I	CCWWGG	1 cut(s)	573
EcoT38I	GRGCYC	1 cut(s)	345
ErhI	CCWWGG	1 cut(s)	573
FaeI	CATG	3 cut(s)	151, 469, 818
FaiI	YATR	9 cut(s)	32, 138, 149, 177, 278, 467, 660, 679, 816
FaqI	GGGAC	2 cut(s)	158, 205
FatI	CATG	3 cut(s)	147, 465, 814
FbaI	TGATCA	1 cut(s)	439
FblI	GTMKAC	2 cut(s)	21, 659
Fnu4HI	GCNGC	2 cut(s)	74, 738
FokI	GGATG	4 cut(s)	50, 617, 723, 905
FriOI	GRGCYC	1 cut(s)	345
Fsp4HI	GCNGC	2 cut(s)	74, 738
FspBI	CTAG	1 cut(s)	635
GlaI	GCGC	2 cut(s)	98, 741
GluI	GCNGC	2 cut(s)	74, 738
GsaI	CCCAGC	1 cut(s)	368
HaeIII	GGCC	3 cut(s)	257, 491, 572
HapII	CCGG	2 cut(s)	89, 848
HhaI	GCGC	2 cut(s)	99, 742
Hin1II	CATG	3 cut(s)	151, 469, 818
Hin6I	GCGC	2 cut(s)	97, 740
HinP1I	GCGC	2 cut(s)	97, 740
HincII	GTYRAC	4 cut(s)	22, 82, 112, 163
HindII	GTYRAC	4 cut(s)	22, 82, 112, 163
HinfI	GANTC	8 cut(s)	52, 218, 268, 301, 314, 358, 611, 790
HpaII	CCGG	2 cut(s)	89, 848
HphI	GGTGA	4 cut(s)	209, 707, 851, 919
Hpy166II	GTNNAC	6 cut(s)	22, 82, 112, 163, 200, 660
Hpy188I	TCNGA	3 cut(s)	133, 652, 748
Hpy188III	TCNNGA	5 cut(s)	119, 305, 562, 595, 815
Hpy8I	GTNNAC	6 cut(s)	22, 82, 112, 163, 200, 660
HpyAV	CCTTC	6 cut(s)	224, 412, 466, 694, 753, 774
HpyCH4III	ACNGT	3 cut(s)	104, 181, 590
HpyCH4IV	ACGT	1 cut(s)	114
HpyCH4V	TGCA	1 cut(s)	329
HpySE526I	ACGT	1 cut(s)	114
Hsp92II	CATG	3 cut(s)	151, 469, 818
HspAI	GCGC	2 cut(s)	97, 740
Ksp22I	TGATCA	1 cut(s)	439
Kzo9I	GATC	2 cut(s)	439, 919
LmnI	GCTCC	2 cut(s)	340, 564
Lsp1109I	GCAGC	2 cut(s)	85, 724
LweI	GCATC	2 cut(s)	28, 775
MaeI	CTAG	1 cut(s)	635
MaeII	ACGT	1 cut(s)	114
MaeIII	GTNAC	4 cut(s)	584, 772, 839, 907
MalI	GATC	2 cut(s)	441, 921
MboI	GATC	2 cut(s)	439, 919
MboII	GAAGA	2 cut(s)	277, 896
MhlI	GDGCHC	2 cut(s)	345, 871
MlsI	TGGCCA	1 cut(s)	257
MluCI	AATT	4 cut(s)	122, 184, 259, 279
MluNI	TGGCCA	1 cut(s)	257
MlyI	GAGTC	4 cut(s)	46, 308, 352, 799
MmeI	TCCRAC	1 cut(s)	291
Mox20I	TGGCCA	1 cut(s)	257
MscI	TGGCCA	1 cut(s)	257
MseI	TTAA	3 cut(s)	459, 486, 672
MslI	CAYNNNNRTG	1 cut(s)	693
Msp20I	TGGCCA	1 cut(s)	257
MspA1I	CMGCKG	1 cut(s)	364
MspI	CCGG	2 cut(s)	89, 848
MspR9I	CCNGG	6 cut(s)	43, 64, 90, 320, 608, 795
MvaI	CCWGG	5 cut(s)	43, 64, 320, 608, 795
NciI	CCSGG	1 cut(s)	90
NdeII	GATC	2 cut(s)	439, 919
NlaIII	CATG	3 cut(s)	151, 469, 818
NmeAIII	GCCGAG	1 cut(s)	34
NmuCI	GTSAC	2 cut(s)	839, 907
PagI	TCATGA	1 cut(s)	814
PfeI	GAWTC	4 cut(s)	218, 268, 301, 611
PfoI	TCCNGGA	1 cut(s)	606
PkrI	GCNGC	2 cut(s)	75, 739
PleI	GAGTC	4 cut(s)	46, 308, 352, 798
PpsI	GAGTC	4 cut(s)	46, 308, 352, 798
Psp124BI	GAGCTC	1 cut(s)	345
Psp6I	CCWGG	5 cut(s)	41, 62, 318, 606, 793
PspFI	CCCAGC	1 cut(s)	364
PspGI	CCWGG	5 cut(s)	41, 62, 318, 606, 793
PvuII	CAGCTG	1 cut(s)	364
RseI	CAYNNNNRTG	1 cut(s)	693
SacI	GAGCTC	1 cut(s)	345
SalI	GTCGAC	1 cut(s)	20
SaqAI	TTAA	3 cut(s)	459, 486, 672
SatI	GCNGC	2 cut(s)	74, 738
Sau3AI	GATC	2 cut(s)	439, 919
SchI	GAGTC	4 cut(s)	46, 308, 352, 799
ScrFI	CCNGG	6 cut(s)	43, 64, 90, 320, 608, 795
SduI	GDGCHC	2 cut(s)	345, 871
SfaNI	GCATC	2 cut(s)	28, 775
SmiMI	CAYNNNNRTG	1 cut(s)	693
SmlI	CTYRAG	2 cut(s)	203, 595
SmoI	CTYRAG	2 cut(s)	203, 595
Sse9I	AATT	4 cut(s)	122, 184, 259, 279
SsiI	CCGC	1 cut(s)	293
SspMI	CTAG	1 cut(s)	635
SstI	GAGCTC	1 cut(s)	345
StyD4I	CCNGG	6 cut(s)	41, 62, 88, 318, 606, 793
StyI	CCWWGG	1 cut(s)	573
TaaI	ACNGT	3 cut(s)	104, 181, 590
TaiI	ACGT	1 cut(s)	117
TaqI	TCGA	1 cut(s)	21
TasI	AATT	4 cut(s)	122, 184, 259, 279
TfiI	GAWTC	4 cut(s)	218, 268, 301, 611
Tru1I	TTAA	3 cut(s)	459, 486, 672
Tru9I	TTAA	3 cut(s)	459, 486, 672
TscAI	CASTG	1 cut(s)	595
TseFI	GTSAC	2 cut(s)	839, 907
TseI	GCWGC	2 cut(s)	73, 737
Tsp45I	GTSAC	2 cut(s)	839, 907
TspDTI	ATGAA	2 cut(s)	831, 909
TspRI	CASTG	1 cut(s)	595
XapI	RAATTY	2 cut(s)	122, 184
XcmI	CCANNNNNNNNNTGG	1 cut(s)	361
XmiI	GTMKAC	2 cut(s)	21, 659
XspI	CTAG	1 cut(s)	635

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.