Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005665.1

Orthogroup ID

OG0004212

Physical Location & Seq

Genomic Coordinates Reverse (-)

43151 .. 44519

Gene Structure 1369 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005665.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 888 bp

atgacacttgacaagaatgatcctggacttcgtgcaaggattctccagcaacgtcaagccataaaggggccaattgggcccagaccattggtccctgctaatgaagacatgtcttcacctaagcccccaagtcccaagtctcgggcccgaccacccaggcctccatccccccctggatttaggagggcaacgatcagatctcccattgatttgtttgaaaaaacctcaggaaaaagaagaatgggtgaggaggtgcagggaaagcaagaccttctgaagaagagaatgagggcgtgtgatgaggtcgacaatcttatggaggatgccaagagggagactcggcagtccagggctaggcagccagttgacactcagggttgtaagaaaaacaaggatttggaggtggaagtccaagacctcagagagagggttaagggtctcaggagcaaggccaaggttggtcgtaacagtgtcttgagggagttccaggattctaaagaatacaaggacatcctagagaatagctactcagaggggtatactgacttgcttaatctatgcgtagagcattttggtgagaagggtatgggatgggcagtttctttgggtgttgatgctgcgccttcagaaatcaagggtagcccttctaaggttacacttgctgatgcgagtccaggtcttaccctgtcaggtcatgaagttgagggattggacagtggaggagtcgaccaggcaagcgggtcggtattgggagacgaacctaccgaggcactaagcgacgaccttcagcaaggtaagtctggcactggtgacactccggctgaggacaaagggagtgctcttggagatggggatgaaagggctaaggtgacaaatgccgatccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

295

Amino Acids

32.02

Weight (kDa)

6.27

Isoelectric Point (pI)

54.99

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004212)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g00910 FvH4_2g19120
malus_domestica	MD00G1026400.v1.1 MD05G1342000.v1.1
rosa_chinensis	RchiOBHm_Chr1g0325301 RchiOBHm_Chr6g0267261
rosa_laevigata	RLG00000002306 RLG00000008304 RLG00000008305 RLG00000023168 RLG00000023169 RLG00000034344 RLG00000034345
rosa_multiflora	Rmu_sc0000226.1_g000007 Rmu_sc0002280.1_g000010 Rmu_sc0002724.1_g000006 Rmu_sc0003945.1_g000015 Rmu_sc0005665.1_g000015 Rmu_sc0015523.1_g000014
rosa_roxburghii	Rroxscaffold_2G00155190 Rroxscaffold_2G00155200 Rroxscaffold_2G00155210 Rroxscaffold_2G00155220 Rroxscaffold_3G00238450 Rroxscaffold_3G00238460 Rroxscaffold_4G00318960 Rroxscaffold_4G00318980 Rroxscaffold_7G00215260
rosa_samantha	Rh1DG282300 Rh2DG050600 Rh3AG252200 Rh7AG090900 Rh7AG425200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	343
AccI	GTMKAC	3 cut(s)	306, 539, 726
AciI	CCGC	1 cut(s)	738
AclWI	GGATC	2 cut(s)	14, 875
AcuI	CTGAAG	3 cut(s)	296, 609, 770
AfiI	CCNNNNNNNGG	4 cut(s)	66, 141, 354, 649
AflIII	ACRYGT	1 cut(s)	108
AgsI	TTSAA	1 cut(s)	218
AhdI	GACNNNNNGTC	1 cut(s)	89
AjnI	CCWGG	7 cut(s)	22, 155, 172, 347, 486, 673, 729
AluBI	AGCT	1 cut(s)	525
AluI	AGCT	1 cut(s)	525
Alw21I	GWGCWC	1 cut(s)	841
Alw26I	GTCTC	4 cut(s)	144, 329, 443, 747
AlwI	GGATC	2 cut(s)	14, 875
Ama87I	CYCGRG	1 cut(s)	141
AoxI	GGCC	5 cut(s)	68, 77, 144, 158, 450
ApaI	GGGCCC	2 cut(s)	81, 148
ApeKI	GCWGC	2 cut(s)	358, 617
AspLEI	GCGC	1 cut(s)	622
AspS9I	GGNCC	6 cut(s)	68, 77, 78, 91, 144, 145
AsuHPI	GGTGA	5 cut(s)	108, 257, 587, 821, 880
AvaI	CYCGRG	1 cut(s)	141
AvaII	GGWCC	1 cut(s)	91
AxyI	CCTNAGG	1 cut(s)	226
BaeGI	GKGCMC	2 cut(s)	81, 148
BanII	GRGCYC	2 cut(s)	81, 148
BbsI	GAAGAC	2 cut(s)	105, 111
Bbv12I	GWGCWC	1 cut(s)	841
BbvCI	CCTCAGC	1 cut(s)	822
BbvI	GCAGC	2 cut(s)	370, 604
BccI	CCATC	3 cut(s)	172, 585, 842
BcgI	CGANNNNNNTGC	2 cut(s)	723, 757
BciT130I	CCWGG	7 cut(s)	24, 157, 174, 349, 488, 675, 731
BcoDI	GTCTC	4 cut(s)	144, 329, 443, 747
BfaI	CTAG	2 cut(s)	354, 515
BglI	GCCNNNNNGGC	1 cut(s)	76
BglII	AGATCT	1 cut(s)	197
BisI	GCNGC	2 cut(s)	359, 618
BlsI	GCNGC	2 cut(s)	360, 619
Bme1390I	CCNGG	7 cut(s)	24, 157, 174, 349, 488, 675, 731
Bme18I	GGWCC	1 cut(s)	91
BmeRI	GACNNNNNGTC	1 cut(s)	89
BmeT110I	CYCGRG	1 cut(s)	141
BmgT120I	GGNCC	6 cut(s)	68, 77, 78, 91, 144, 145
BmiI	GGNNCC	4 cut(s)	69, 79, 93, 146
BmrFI	CCNGG	7 cut(s)	24, 157, 174, 349, 488, 675, 731
BmsI	GCATC	3 cut(s)	313, 604, 655
BpiI	GAAGAC	2 cut(s)	105, 111
BplI	GAGNNNNNCTC	2 cut(s)	322, 354
BpmI	CTGGAG	1 cut(s)	29
Bpu10I	CCTNAGC	3 cut(s)	120, 822, 864
BpuEI	CTTGAG	1 cut(s)	496
BsaI	GGTCTC	1 cut(s)	443
BsaJI	CCNNGG	5 cut(s)	155, 172, 348, 453, 765
Bsc4I	CCNNNNNNNGG	4 cut(s)	66, 141, 354, 649
Bse1I	ACTGG	2 cut(s)	362, 811
Bse21I	CCTNAGG	1 cut(s)	226
BseBI	CCWGG	7 cut(s)	24, 157, 174, 349, 488, 675, 731
BseDI	CCNNGG	5 cut(s)	155, 172, 348, 453, 765
BseGI	GGATG	5 cut(s)	164, 328, 510, 596, 859
BseLI	CCNNNNNNNGG	4 cut(s)	66, 141, 354, 649
BseMII	CTCAG	6 cut(s)	240, 386, 433, 454, 543, 813
BseNI	ACTGG	2 cut(s)	362, 811
BseRI	GAGGAG	2 cut(s)	263, 735
BseSI	GKGCMC	2 cut(s)	81, 148
BseXI	GCAGC	2 cut(s)	370, 604
BsgI	GTGCAG	1 cut(s)	275
BshFI	GGCC	5 cut(s)	70, 79, 146, 160, 452
BsiHKAI	GWGCWC	1 cut(s)	841
BsiHKCI	CYCGRG	1 cut(s)	141
BsiSI	CCGG	1 cut(s)	818
BslFI	GGGAC	2 cut(s)	77, 117
BslI	CCNNNNNNNGG	4 cut(s)	66, 141, 354, 649
BsmAI	GTCTC	4 cut(s)	144, 329, 443, 747
BsmBI	CGTCTC	1 cut(s)	747
BsmFI	GGGAC	2 cut(s)	77, 117
BsnI	GGCC	5 cut(s)	70, 79, 146, 160, 452
Bso31I	GGTCTC	1 cut(s)	443
BsoBI	CYCGRG	1 cut(s)	141
Bsp120I	GGGCCC	2 cut(s)	77, 144
Bsp1286I	GDGCHC	3 cut(s)	81, 148, 841
Bsp143I	GATC	4 cut(s)	19, 192, 197, 880
BspACI	CCGC	1 cut(s)	738
BspANI	GGCC	5 cut(s)	70, 79, 146, 160, 452
BspCNI	CTCAG	6 cut(s)	239, 385, 432, 453, 542, 814
BspHI	TCATGA	1 cut(s)	694
BspLI	GGNNCC	4 cut(s)	69, 79, 93, 146
BspPI	GGATC	2 cut(s)	14, 875
BspTNI	GGTCTC	1 cut(s)	443
BsrI	ACTGG	2 cut(s)	362, 811
BssECI	CCNNGG	5 cut(s)	155, 172, 348, 453, 765
BssMI	GATC	4 cut(s)	19, 192, 197, 880
BssNAI	GTATAC	1 cut(s)	540
BssT1I	CCWWGG	1 cut(s)	453
Bst1107I	GTATAC	1 cut(s)	540
Bst2UI	CCWGG	7 cut(s)	24, 157, 174, 349, 488, 675, 731
Bst4CI	ACNGT	2 cut(s)	470, 716
Bst6I	CTCTTC	1 cut(s)	275
BstC8I	GCNNGC	1 cut(s)	736
BstF5I	GGATG	5 cut(s)	164, 328, 510, 596, 859
BstHHI	GCGC	1 cut(s)	622
BstKTI	GATC	4 cut(s)	22, 195, 200, 883
BstMAI	GTCTC	4 cut(s)	144, 329, 443, 747
BstMBI	GATC	4 cut(s)	19, 192, 197, 880
BstMWI	GCNNNNNNNGC	2 cut(s)	76, 262
BstNI	CCWGG	7 cut(s)	24, 157, 174, 349, 488, 675, 731
BstNSI	RCATGY	1 cut(s)	112
BstSCI	CCNGG	7 cut(s)	22, 155, 172, 347, 486, 673, 729
BstSLI	GKGCMC	2 cut(s)	81, 148
BstV1I	GCAGC	2 cut(s)	370, 604
BstV2I	GAAGAC	2 cut(s)	105, 111
BstX2I	RGATCY	1 cut(s)	197
BstXI	CCANNNNNNTGG	1 cut(s)	88
BstYI	RGATCY	1 cut(s)	197
BstZ17I	GTATAC	1 cut(s)	540
Bsu36I	CCTNAGG	1 cut(s)	226
BsuRI	GGCC	5 cut(s)	70, 79, 146, 160, 452
BtsCI	GGATG	5 cut(s)	164, 328, 510, 596, 859
BtsIMutI	CAGTG	3 cut(s)	475, 721, 804
Cac8I	GCNNGC	1 cut(s)	736
CciI	TCATGA	1 cut(s)	694
CfoI	GCGC	1 cut(s)	622
Cfr13I	GGNCC	6 cut(s)	68, 77, 78, 91, 144, 145
CviAII	CATG	2 cut(s)	109, 695
DpnI	GATC	4 cut(s)	21, 194, 199, 882
DpnII	GATC	4 cut(s)	19, 192, 197, 880
DrdI	GACNNNNNNGTC	1 cut(s)	343
DriI	GACNNNNNGTC	1 cut(s)	89
DseDI	GACNNNNNNGTC	1 cut(s)	343
Eam1104I	CTCTTC	1 cut(s)	275
Eam1105I	GACNNNNNGTC	1 cut(s)	89
EarI	CTCTTC	1 cut(s)	275
Eco130I	CCWWGG	1 cut(s)	453
Eco147I	AGGCCT	1 cut(s)	160
Eco24I	GRGCYC	2 cut(s)	81, 148
Eco31I	GGTCTC	1 cut(s)	443
Eco47I	GGWCC	1 cut(s)	91
Eco57I	CTGAAG	3 cut(s)	296, 609, 770
Eco81I	CCTNAGG	1 cut(s)	226
Eco88I	CYCGRG	1 cut(s)	141
EcoRII	CCWGG	7 cut(s)	22, 155, 172, 347, 486, 673, 729
EcoT14I	CCWWGG	1 cut(s)	453
EcoT38I	GRGCYC	2 cut(s)	81, 148
ErhI	CCWWGG	1 cut(s)	453
Esp3I	CGTCTC	1 cut(s)	747
FaeI	CATG	2 cut(s)	112, 698
FaiI	YATR	7 cut(s)	62, 110, 317, 540, 559, 587, 696
FaqI	GGGAC	2 cut(s)	77, 117
FatI	CATG	2 cut(s)	108, 694
FauI	CCCGC	1 cut(s)	731
FblI	GTMKAC	3 cut(s)	306, 539, 726
Fnu4HI	GCNGC	2 cut(s)	359, 618
FokI	GGATG	5 cut(s)	151, 335, 497, 603, 866
FriOI	GRGCYC	2 cut(s)	81, 148
Fsp4HI	GCNGC	2 cut(s)	359, 618
FspBI	CTAG	2 cut(s)	354, 515
GlaI	GCGC	1 cut(s)	621
GluI	GCNGC	2 cut(s)	359, 618
GsuI	CTGGAG	1 cut(s)	29
HaeIII	GGCC	5 cut(s)	70, 79, 146, 160, 452
HapII	CCGG	1 cut(s)	818
HhaI	GCGC	1 cut(s)	622
Hin1II	CATG	2 cut(s)	112, 698
Hin6I	GCGC	1 cut(s)	620
HinP1I	GCGC	1 cut(s)	620
HincII	GTYRAC	3 cut(s)	307, 367, 727
HindII	GTYRAC	3 cut(s)	307, 367, 727
HinfI	GANTC	5 cut(s)	40, 337, 491, 670, 723
HpaII	CCGG	1 cut(s)	818
HphI	GGTGA	5 cut(s)	108, 257, 587, 821, 880
Hpy166II	GTNNAC	4 cut(s)	307, 367, 540, 727
Hpy188I	TCNGA	5 cut(s)	197, 276, 422, 532, 628
Hpy188III	TCNNGA	4 cut(s)	228, 442, 475, 695
Hpy8I	GTNNAC	4 cut(s)	307, 367, 540, 727
Hpy99I	CGWCG	1 cut(s)	782
HpyAV	CCTTC	5 cut(s)	281, 574, 633, 654, 794
HpyCH4III	ACNGT	2 cut(s)	470, 716
HpyCH4IV	ACGT	1 cut(s)	52
HpyCH4V	TGCA	2 cut(s)	35, 256
HpyF10VI	GCNNNNNNNGC	2 cut(s)	76, 262
HpySE526I	ACGT	1 cut(s)	52
Hsp92II	CATG	2 cut(s)	112, 698
HspAI	GCGC	1 cut(s)	620
Kzo9I	GATC	4 cut(s)	19, 192, 197, 880
LmnI	GCTCC	1 cut(s)	444
Lsp1109I	GCAGC	2 cut(s)	370, 604
LweI	GCATC	3 cut(s)	313, 604, 655
MaeI	CTAG	2 cut(s)	354, 515
MaeII	ACGT	1 cut(s)	52
MaeIII	GTNAC	4 cut(s)	464, 652, 809, 868
MalI	GATC	4 cut(s)	21, 194, 199, 882
MboI	GATC	4 cut(s)	19, 192, 197, 880
MboII	GAAGA	5 cut(s)	105, 116, 249, 289, 292
MfeI	CAATTG	1 cut(s)	72
MflI	RGATCY	1 cut(s)	197
MhlI	GDGCHC	3 cut(s)	81, 148, 841
MluCI	AATT	1 cut(s)	72
MlyI	GAGTC	3 cut(s)	331, 679, 732
MseI	TTAA	2 cut(s)	432, 552
MslI	CAYNNNNRTG	1 cut(s)	573
MspI	CCGG	1 cut(s)	818
MspR9I	CCNGG	7 cut(s)	24, 157, 174, 349, 488, 675, 731
MunI	CAATTG	1 cut(s)	72
MvaI	CCWGG	7 cut(s)	24, 157, 174, 349, 488, 675, 731
MwoI	GCNNNNNNNGC	2 cut(s)	76, 262
NdeII	GATC	4 cut(s)	19, 192, 197, 880
NlaIII	CATG	2 cut(s)	112, 698
NlaIV	GGNNCC	4 cut(s)	69, 79, 93, 146
NmeAIII	GCCGAG	1 cut(s)	319
NmuCI	GTSAC	2 cut(s)	809, 868
NspI	RCATGY	1 cut(s)	112
PagI	TCATGA	1 cut(s)	694
PceI	AGGCCT	1 cut(s)	160
PciI	ACATGT	1 cut(s)	108
PcsI	WCGNNNNNNNCGW	1 cut(s)	762
PfeI	GAWTC	2 cut(s)	40, 491
PfoI	TCCNGGA	2 cut(s)	22, 486
PkrI	GCNGC	2 cut(s)	360, 619
PleI	GAGTC	3 cut(s)	331, 678, 731
PpsI	GAGTC	3 cut(s)	331, 678, 731
PscI	ACATGT	1 cut(s)	108
Psp6I	CCWGG	7 cut(s)	22, 155, 172, 347, 486, 673, 729
PspGI	CCWGG	7 cut(s)	22, 155, 172, 347, 486, 673, 729
PspN4I	GGNNCC	4 cut(s)	69, 79, 93, 146
PspOMI	GGGCCC	2 cut(s)	77, 144
PspPI	GGNCC	6 cut(s)	68, 77, 78, 91, 144, 145
PsuI	RGATCY	1 cut(s)	197
RseI	CAYNNNNRTG	1 cut(s)	573
SalI	GTCGAC	2 cut(s)	305, 725
SaqAI	TTAA	2 cut(s)	432, 552
SatI	GCNGC	2 cut(s)	359, 618
Sau3AI	GATC	4 cut(s)	19, 192, 197, 880
Sau96I	GGNCC	6 cut(s)	68, 77, 78, 91, 144, 145
SchI	GAGTC	3 cut(s)	331, 679, 732
ScrFI	CCNGG	7 cut(s)	24, 157, 174, 349, 488, 675, 731
SduI	GDGCHC	3 cut(s)	81, 148, 841
SfaNI	GCATC	3 cut(s)	313, 604, 655
SfiI	GGCCNNNNNGGCC	1 cut(s)	76
SinI	GGWCC	1 cut(s)	91
SmiMI	CAYNNNNRTG	1 cut(s)	573
SmlI	CTYRAG	1 cut(s)	475
SmoI	CTYRAG	1 cut(s)	475
Sse9I	AATT	1 cut(s)	72
SseBI	AGGCCT	1 cut(s)	160
SsiI	CCGC	1 cut(s)	738
SspMI	CTAG	2 cut(s)	354, 515
StuI	AGGCCT	1 cut(s)	160
StyD4I	CCNGG	7 cut(s)	22, 155, 172, 347, 486, 673, 729
StyI	CCWWGG	1 cut(s)	453
TaaI	ACNGT	2 cut(s)	470, 716
TaiI	ACGT	1 cut(s)	55
TaqI	TCGA	2 cut(s)	306, 726
TasI	AATT	1 cut(s)	72
TfiI	GAWTC	2 cut(s)	40, 491
Tru1I	TTAA	2 cut(s)	432, 552
Tru9I	TTAA	2 cut(s)	432, 552
TscAI	CASTG	3 cut(s)	475, 721, 811
TseFI	GTSAC	2 cut(s)	809, 868
TseI	GCWGC	2 cut(s)	358, 617
Tsp45I	GTSAC	2 cut(s)	809, 868
TspDTI	ATGAA	3 cut(s)	117, 711, 870
TspRI	CASTG	3 cut(s)	475, 721, 811
VpaK11BI	GGWCC	1 cut(s)	91
XceI	RCATGY	1 cut(s)	112
XmiI	GTMKAC	3 cut(s)	306, 539, 726
XspI	CTAG	2 cut(s)	354, 515

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.