MD07G1028100.v1.1

Purple acid phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0002404
Physical Location & Seq
Reverse (-)
2348608 .. 2349147
540 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1028100.v1.1.491

Sequence Viewer

Length: 282 bp
ATGCCAACCTCAGCAAAGGATAAGCCATGGTATTCCATAGAACAAGCAAGTGTTCACATTACGGTGATTTCAACAGAGCATGACTGGTCCACAAATTCTGAGCAGTATCAATGGATGAGAAAGGACATTGCTTCAGTTGATCGATCTAAAACTCCTTGGTTGATTTTTATGGGGCATAGACCCATGTATTCCTCCTCACCTGGATTCCTCAATGTTGATAAAATATTTGTCAACGAAGTGGAACCATTACTGCTCGAGAGCAAAGTAACATCCCTTCCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Metallophos Metallophos_C Pur_ac_phosph_N

Protein Analysis

94

Amino Acids

10.74

Weight (kDa)

5.84

Isoelectric Point (pI)

45.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 94
AcuI CTGAAG 1 cut(s) 117
AgsI TTSAA 1 cut(s) 72
AjnI CCWGG 1 cut(s) 199
Ama87I CYCGRG 1 cut(s) 254
ApoI RAATTY 1 cut(s) 94
AspS9I GGNCC 1 cut(s) 87
AsuHPI GGTGA 2 cut(s) 76, 189
AvaI CYCGRG 1 cut(s) 254
AvaII GGWCC 1 cut(s) 87
BarI GAAGNNNNNNTAC 1 cut(s) 258
BbvCI CCTCAGC 1 cut(s) 10
BciT130I CCWGG 1 cut(s) 201
BfaI CTAG 1 cut(s) 280
Bme1390I CCNGG 1 cut(s) 201
Bme18I GGWCC 1 cut(s) 87
BmeT110I CYCGRG 1 cut(s) 254
BmgT120I GGNCC 1 cut(s) 87
BmiI GGNNCC 1 cut(s) 243
BmrFI CCNGG 1 cut(s) 201
Bpu10I CCTNAGC 1 cut(s) 10
Bsa29I ATCGAT 1 cut(s) 142
BsaJI CCNNGG 2 cut(s) 26, 155
Bse1I ACTGG 1 cut(s) 89
Bse3DI GCAATG 1 cut(s) 126
BseBI CCWGG 1 cut(s) 201
BseCI ATCGAT 1 cut(s) 142
BseDI CCNNGG 2 cut(s) 26, 155
BseGI GGATG 2 cut(s) 120, 269
BseMI GCAATG 1 cut(s) 126
BseMII CTCAG 2 cut(s) 24, 90
BseNI ACTGG 1 cut(s) 89
BseRI GAGGAG 1 cut(s) 184
BshVI ATCGAT 1 cut(s) 142
BsiHKCI CYCGRG 1 cut(s) 254
BsoBI CYCGRG 1 cut(s) 254
Bsp143I GATC 2 cut(s) 139, 143
Bsp19I CCATGG 1 cut(s) 26
BspCNI CTCAG 2 cut(s) 23, 91
BspDI ATCGAT 1 cut(s) 142
BspLI GGNNCC 1 cut(s) 243
BsrDI GCAATG 1 cut(s) 126
BsrI ACTGG 1 cut(s) 89
BssECI CCNNGG 2 cut(s) 26, 155
BssMI GATC 2 cut(s) 139, 143
BssT1I CCWWGG 2 cut(s) 26, 155
Bst2UI CCWGG 1 cut(s) 201
Bst4CI ACNGT 1 cut(s) 64
BstDEI CTNAG 2 cut(s) 10, 99
BstDSI CCRYGG 1 cut(s) 26
BstF5I GGATG 2 cut(s) 120, 269
BstKTI GATC 2 cut(s) 142, 146
BstMBI GATC 2 cut(s) 139, 143
BstNI CCWGG 1 cut(s) 201
BstSCI CCNGG 1 cut(s) 199
Bsu15I ATCGAT 1 cut(s) 142
BsuTUI ATCGAT 1 cut(s) 142
BtgI CCRYGG 1 cut(s) 26
BtsCI GGATG 2 cut(s) 120, 269
Cfr13I GGNCC 1 cut(s) 87
ClaI ATCGAT 1 cut(s) 142
CviAII CATG 3 cut(s) 27, 80, 184
CviJI RGCY 1 cut(s) 25
CviKI_1 RGCY 1 cut(s) 25
DdeI CTNAG 2 cut(s) 10, 99
DpnI GATC 2 cut(s) 141, 145
DpnII GATC 2 cut(s) 139, 143
Eco130I CCWWGG 2 cut(s) 26, 155
Eco47I GGWCC 1 cut(s) 87
Eco57I CTGAAG 1 cut(s) 117
Eco88I CYCGRG 1 cut(s) 254
EcoRII CCWGG 1 cut(s) 199
EcoT14I CCWWGG 2 cut(s) 26, 155
ErhI CCWWGG 2 cut(s) 26, 155
FaeI CATG 3 cut(s) 30, 83, 187
FaiI YATR 6 cut(s) 28, 38, 81, 170, 177, 185
FatI CATG 3 cut(s) 26, 79, 183
FokI GGATG 2 cut(s) 127, 256
FspBI CTAG 1 cut(s) 280
Hin1II CATG 3 cut(s) 30, 83, 187
HincII GTYRAC 1 cut(s) 232
HindII GTYRAC 1 cut(s) 232
HinfI GANTC 1 cut(s) 204
HphI GGTGA 2 cut(s) 76, 189
Hpy166II GTNNAC 3 cut(s) 55, 90, 232
Hpy188I TCNGA 1 cut(s) 100
Hpy188III TCNNGA 1 cut(s) 256
Hpy8I GTNNAC 3 cut(s) 55, 90, 232
HpyCH4III ACNGT 1 cut(s) 64
HpyF3I CTNAG 2 cut(s) 10, 99
Hsp92II CATG 3 cut(s) 30, 83, 187
Kzo9I GATC 2 cut(s) 139, 143
LpnPI CCDG 3 cut(s) 70, 186, 213
MaeI CTAG 1 cut(s) 280
MaeIII GTNAC 1 cut(s) 265
MalI GATC 2 cut(s) 141, 145
MboI GATC 2 cut(s) 139, 143
MluCI AATT 1 cut(s) 94
MnlI CCTC 4 cut(s) 19, 202, 205, 218
MslI CAYNNNNRTG 1 cut(s) 62
MspR9I CCNGG 1 cut(s) 201
MvaI CCWGG 1 cut(s) 201
NcoI CCATGG 1 cut(s) 26
NdeII GATC 2 cut(s) 139, 143
NlaIII CATG 3 cut(s) 30, 83, 187
NlaIV GGNNCC 1 cut(s) 243
PaeR7I CTCGAG 1 cut(s) 254
PfeI GAWTC 1 cut(s) 204
Psp6I CCWGG 1 cut(s) 199
PspGI CCWGG 1 cut(s) 199
PspN4I GGNNCC 1 cut(s) 243
PspPI GGNCC 1 cut(s) 87
RseI CAYNNNNRTG 1 cut(s) 62
Sau3AI GATC 2 cut(s) 139, 143
Sau96I GGNCC 1 cut(s) 87
ScrFI CCNGG 1 cut(s) 201
SetI ASST 2 cut(s) 11, 202
Sfr274I CTCGAG 1 cut(s) 254
SinI GGWCC 1 cut(s) 87
SlaI CTCGAG 1 cut(s) 254
SmiMI CAYNNNNRTG 1 cut(s) 62
SmlI CTYRAG 1 cut(s) 254
SmoI CTYRAG 1 cut(s) 254
Sse9I AATT 1 cut(s) 94
SspI AATATT 1 cut(s) 225
SspMI CTAG 1 cut(s) 280
StyD4I CCNGG 1 cut(s) 199
StyI CCWWGG 2 cut(s) 26, 155
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 2 cut(s) 142, 255
TasI AATT 1 cut(s) 94
TfiI GAWTC 1 cut(s) 204
VpaK11BI GGWCC 1 cut(s) 87
XapI RAATTY 1 cut(s) 94
XhoI CTCGAG 1 cut(s) 254
XspI CTAG 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.