Rh4CG304500

Purple acid phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0002404
Physical Location & Seq
Forward (+)
56510107 .. 56511203
1097 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG304500.1

Sequence Viewer

Length: 348 bp
ATGACAGCTATCGGGAACCATGAGAGGGACTATATAGACTCTGGATCAGTGTACATTCTTGCAGATTCAGGTGGGGAAGTTGGAGTTCCCTATGAGACTTACTTTCCAATGCCAACCCCAGCAAAGGATAAACCATGGTATTCCACAGAACAAGGAAGCGTCCACATCACGATGATTTCAACAGAGCATGACTGGACCAAAAATTCTGAGCAGGGCTGTAGATTATCCGAGGGAGAAAGATGGAGCACGACTTCAGATGAGACTATCTTACAGTCCAGTTGCAAATTTATTTCTCTTTCTTGTTCAGTGGATGGATTACCAGCTTGCTGGGGGCCTTGGCTTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0003993 GO:0006793 GO:0006796 GO:0008150 GO:0008152 GO:0009987 GO:0016311 GO:0016787 GO:0016788 GO:0016791 GO:0042578 GO:0044237
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Metallophos Metallophos_C Pur_ac_phosph_N

Protein Analysis

115

Amino Acids

12.73

Weight (kDa)

4.51

Isoelectric Point (pI)

57.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 52
AcsI RAATTY 2 cut(s) 202, 284
AcuI CTGAAG 1 cut(s) 237
AfaI GTAC 1 cut(s) 53
AfiI CCNNNNNNNGG 2 cut(s) 25, 124
AgsI TTSAA 1 cut(s) 180
AluBI AGCT 2 cut(s) 8, 323
AluI AGCT 2 cut(s) 8, 323
Alw21I GWGCWC 1 cut(s) 248
Alw26I GTCTC 2 cut(s) 89, 254
AlwI GGATC 1 cut(s) 52
AoxI GGCC 1 cut(s) 332
ApoI RAATTY 2 cut(s) 202, 284
AspS9I GGNCC 2 cut(s) 195, 332
AvaII GGWCC 1 cut(s) 195
Bbv12I GWGCWC 1 cut(s) 248
BccI CCATC 2 cut(s) 234, 305
BcoDI GTCTC 2 cut(s) 89, 254
BfmI CTRYAG 1 cut(s) 217
Bme18I GGWCC 1 cut(s) 195
BmgT120I GGNCC 2 cut(s) 195, 332
BmiI GGNNCC 2 cut(s) 17, 333
BsaJI CCNNGG 3 cut(s) 134, 228, 335
Bsc4I CCNNNNNNNGG 2 cut(s) 25, 124
Bse1I ACTGG 2 cut(s) 197, 276
BseDI CCNNGG 3 cut(s) 134, 228, 335
BseGI GGATG 1 cut(s) 316
BseLI CCNNNNNNNGG 2 cut(s) 25, 124
BseMII CTCAG 1 cut(s) 198
BseNI ACTGG 2 cut(s) 197, 276
BseYI CCCAGC 2 cut(s) 118, 327
BshFI GGCC 1 cut(s) 334
BsiHKAI GWGCWC 1 cut(s) 248
BslFI GGGAC 1 cut(s) 41
BslI CCNNNNNNNGG 2 cut(s) 25, 124
BsmAI GTCTC 2 cut(s) 89, 254
BsmFI GGGAC 1 cut(s) 41
BsnI GGCC 1 cut(s) 334
Bsp1286I GDGCHC 1 cut(s) 248
Bsp1407I TGTACA 1 cut(s) 51
Bsp143I GATC 1 cut(s) 44
Bsp19I CCATGG 1 cut(s) 134
BspANI GGCC 1 cut(s) 334
BspCNI CTCAG 1 cut(s) 199
BspLI GGNNCC 2 cut(s) 17, 333
BspPI GGATC 1 cut(s) 52
BsrGI TGTACA 1 cut(s) 51
BsrI ACTGG 2 cut(s) 197, 276
BssECI CCNNGG 3 cut(s) 134, 228, 335
BssMI GATC 1 cut(s) 44
BssT1I CCWWGG 2 cut(s) 134, 335
Bst4CI ACNGT 1 cut(s) 273
BstAUI TGTACA 1 cut(s) 51
BstC8I GCNNGC 2 cut(s) 325, 342
BstDEI CTNAG 2 cut(s) 207, 345
BstDSI CCRYGG 1 cut(s) 134
BstF5I GGATG 1 cut(s) 316
BstKTI GATC 1 cut(s) 47
BstMAI GTCTC 2 cut(s) 89, 254
BstMBI GATC 1 cut(s) 44
BstSFI CTRYAG 1 cut(s) 217
BstXI CCANNNNNNTGG 1 cut(s) 327
BsuRI GGCC 1 cut(s) 334
BtgI CCRYGG 1 cut(s) 134
BtsCI GGATG 1 cut(s) 316
BtsIMutI CAGTG 2 cut(s) 54, 312
Cac8I GCNNGC 2 cut(s) 325, 342
Cfr13I GGNCC 2 cut(s) 195, 332
CseI GACGC 1 cut(s) 148
Csp6I GTAC 1 cut(s) 52
CviAII CATG 3 cut(s) 20, 135, 188
CviJI RGCY 5 cut(s) 8, 216, 323, 334, 340
CviKI_1 RGCY 5 cut(s) 8, 216, 323, 334, 340
CviQI GTAC 1 cut(s) 52
DdeI CTNAG 2 cut(s) 207, 345
DpnI GATC 1 cut(s) 46
DpnII GATC 1 cut(s) 44
Eco130I CCWWGG 2 cut(s) 134, 335
Eco47I GGWCC 1 cut(s) 195
Eco57I CTGAAG 1 cut(s) 237
EcoO109I RGGNCCY 1 cut(s) 332
EcoT14I CCWWGG 2 cut(s) 134, 335
ErhI CCWWGG 2 cut(s) 134, 335
FaeI CATG 3 cut(s) 23, 138, 191
FaiI YATR 6 cut(s) 21, 33, 35, 93, 136, 189
FaqI GGGAC 1 cut(s) 41
FatI CATG 3 cut(s) 19, 134, 187
FokI GGATG 1 cut(s) 323
GsaI CCCAGC 2 cut(s) 122, 331
HaeIII GGCC 1 cut(s) 334
HgaI GACGC 1 cut(s) 148
Hin1II CATG 3 cut(s) 23, 138, 191
HinfI GANTC 2 cut(s) 38, 65
Hpy166II GTNNAC 2 cut(s) 52, 163
Hpy188I TCNGA 3 cut(s) 208, 229, 256
Hpy188III TCNNGA 3 cut(s) 13, 42, 169
Hpy8I GTNNAC 2 cut(s) 52, 163
HpyCH4III ACNGT 1 cut(s) 273
HpyCH4V TGCA 2 cut(s) 62, 282
HpyF3I CTNAG 2 cut(s) 207, 345
Hsp92II CATG 3 cut(s) 23, 138, 191
Kzo9I GATC 1 cut(s) 44
LmnI GCTCC 1 cut(s) 243
LpnPI CCDG 8 cut(s) 27, 54, 132, 178, 197, 289, 313, 333
MalI GATC 1 cut(s) 46
MboI GATC 1 cut(s) 44
MhlI GDGCHC 1 cut(s) 248
MluCI AATT 2 cut(s) 202, 284
MlyI GAGTC 1 cut(s) 32
MmeI TCCRAC 1 cut(s) 61
MnlI CCTC 2 cut(s) 18, 223
MslI CAYNNNNRTG 1 cut(s) 170
NcoI CCATGG 1 cut(s) 134
NdeII GATC 1 cut(s) 44
NlaIII CATG 3 cut(s) 23, 138, 191
NlaIV GGNNCC 2 cut(s) 17, 333
PfeI GAWTC 1 cut(s) 65
PleI GAGTC 1 cut(s) 32
PpsI GAGTC 1 cut(s) 32
PspFI CCCAGC 2 cut(s) 118, 327
PspN4I GGNNCC 2 cut(s) 17, 333
PspPI GGNCC 2 cut(s) 195, 332
RsaI GTAC 1 cut(s) 53
RsaNI GTAC 1 cut(s) 52
RseI CAYNNNNRTG 1 cut(s) 170
Sau3AI GATC 1 cut(s) 44
Sau96I GGNCC 2 cut(s) 195, 332
SchI GAGTC 1 cut(s) 32
SduI GDGCHC 1 cut(s) 248
SetI ASST 3 cut(s) 10, 73, 325
SfcI CTRYAG 1 cut(s) 217
SinI GGWCC 1 cut(s) 195
SmiMI CAYNNNNRTG 1 cut(s) 170
Sse9I AATT 2 cut(s) 202, 284
StyI CCWWGG 2 cut(s) 134, 335
TaaI ACNGT 1 cut(s) 273
TasI AATT 2 cut(s) 202, 284
TatI WGTACW 1 cut(s) 51
TfiI GAWTC 1 cut(s) 65
TscAI CASTG 2 cut(s) 54, 312
TspRI CASTG 2 cut(s) 54, 312
VpaK11BI GGWCC 1 cut(s) 195
XapI RAATTY 2 cut(s) 202, 284
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.