Rroxscaffold_1G00030780

Purple acid phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0002404
Physical Location & Seq
Forward (+)
41258461 .. 41262744
4284 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00030780.1

Sequence Viewer

Length: 528 bp
ATGGTATTATCCATAGAACAAGGAAGCGTCTACATCACAATGATTTCAACAGAGCATGACTGGACCAAAAATTCTGAGCAGTATCAATGGATGAAAAAGGACATGGCTTCAGTTGATCGATCTAAAACTCCTTGGTTGATATTTATGGGGCATAGACCAATGTATACATCTGCCCCTGGATTCCTGAGTGTTGATGAGAAATTCGTTGACAAAGTTGAACCATTACTTCTGGCAAGCAAAGTTGATCTGGCGCTGTTTGGTCATGTCCATAACTACGAGCGAACCTGCTCCATTTATAAGAGCCAATGCATGAAATTGCCTTGCAAAGATGAGGCTGGGATCGACACATATGATCACAGCAACTACAGTGCCCCAGTGCAAGCCATAATTGGAACGGCTGGCTTTTCCTTGGACAAGTTTCCCAGTGGTATTAACAATAGTTGGAGTTTATCAAGGCATTCTAAATATGGTTCTCTCAGAGCGCATGCAACAAGGACAGATATCAAATTAGAGGCAAGTAAGAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0003993 GO:0006793 GO:0006796 GO:0008150 GO:0008152 GO:0009987 GO:0016311 GO:0016787 GO:0016788 GO:0016791 GO:0042578 GO:0044237
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Metallophos Metallophos_C Pur_ac_phosph_N

Protein Analysis

175

Amino Acids

19.85

Weight (kDa)

8.37

Isoelectric Point (pI)

28.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Metallophos PF00149 19 - 92 1e-07 Calcineurin-like phosphoesterase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 297
Acc36I ACCTGC 1 cut(s) 293
AccI GTMKAC 2 cut(s) 30, 164
AclWI GGATC 1 cut(s) 347
AcsI RAATTY 2 cut(s) 70, 200
AcuI CTGAAG 1 cut(s) 93
AgsI TTSAA 2 cut(s) 48, 218
AjnI CCWGG 1 cut(s) 175
AlwI GGATC 1 cut(s) 347
ApoI RAATTY 2 cut(s) 70, 200
AspLEI GCGC 2 cut(s) 253, 484
AspS9I GGNCC 1 cut(s) 63
AvaII GGWCC 1 cut(s) 63
BaeGI GKGCMC 1 cut(s) 373
BceAI ACGGC 1 cut(s) 411
BciT130I CCWGG 1 cut(s) 177
BclI TGATCA 1 cut(s) 352
BfmI CTRYAG 1 cut(s) 364
BfoI RGCGCY 1 cut(s) 254
BfuAI ACCTGC 1 cut(s) 293
Bme1390I CCNGG 1 cut(s) 177
Bme18I GGWCC 1 cut(s) 63
BmgT120I GGNCC 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 177
BmrI ACTGGG 2 cut(s) 368, 417
BmuI ACTGGG 2 cut(s) 368, 417
Bsa29I ATCGAT 1 cut(s) 118
BsaJI CCNNGG 3 cut(s) 131, 175, 408
Bse1I ACTGG 3 cut(s) 65, 374, 423
BseBI CCWGG 1 cut(s) 177
BseCI ATCGAT 1 cut(s) 118
BseDI CCNNGG 3 cut(s) 131, 175, 408
BseGI GGATG 1 cut(s) 96
BseMII CTCAG 3 cut(s) 66, 176, 490
BseNI ACTGG 3 cut(s) 65, 374, 423
BseSI GKGCMC 1 cut(s) 373
BseYI CCCAGC 1 cut(s) 335
BshVI ATCGAT 1 cut(s) 118
BsmI GAATGC 1 cut(s) 457
Bsp1286I GDGCHC 1 cut(s) 373
Bsp143I GATC 5 cut(s) 115, 119, 244, 339, 352
BspCNI CTCAG 3 cut(s) 67, 177, 489
BspDI ATCGAT 1 cut(s) 118
BspMI ACCTGC 1 cut(s) 293
BspPI GGATC 1 cut(s) 347
BsrI ACTGG 3 cut(s) 65, 374, 423
BssECI CCNNGG 3 cut(s) 131, 175, 408
BssMI GATC 5 cut(s) 115, 119, 244, 339, 352
BssNAI GTATAC 1 cut(s) 165
BssT1I CCWWGG 2 cut(s) 131, 408
Bst1107I GTATAC 1 cut(s) 165
Bst2UI CCWGG 1 cut(s) 177
Bst4CI ACNGT 1 cut(s) 368
BstC8I GCNNGC 4 cut(s) 235, 381, 400, 486
BstDEI CTNAG 3 cut(s) 75, 185, 476
BstF5I GGATG 1 cut(s) 96
BstH2I RGCGCY 1 cut(s) 254
BstHHI GCGC 2 cut(s) 253, 484
BstKTI GATC 5 cut(s) 118, 122, 247, 342, 355
BstMBI GATC 5 cut(s) 115, 119, 244, 339, 352
BstNI CCWGG 1 cut(s) 177
BstNSI RCATGY 1 cut(s) 488
BstSCI CCNGG 1 cut(s) 175
BstSFI CTRYAG 1 cut(s) 364
BstSLI GKGCMC 1 cut(s) 373
BstZ17I GTATAC 1 cut(s) 165
Bsu15I ATCGAT 1 cut(s) 118
BsuTUI ATCGAT 1 cut(s) 118
BtsCI GGATG 1 cut(s) 96
BtsIMutI CAGTG 3 cut(s) 373, 381, 430
BveI ACCTGC 1 cut(s) 293
Cac8I GCNNGC 4 cut(s) 235, 381, 400, 486
CfoI GCGC 2 cut(s) 253, 484
Cfr13I GGNCC 1 cut(s) 63
ClaI ATCGAT 1 cut(s) 118
CseI GACGC 1 cut(s) 16
CviAII CATG 5 cut(s) 56, 103, 263, 310, 485
CviJI RGCY 6 cut(s) 107, 303, 335, 383, 398, 402
CviKI_1 RGCY 6 cut(s) 107, 303, 335, 383, 398, 402
DdeI CTNAG 3 cut(s) 75, 185, 476
DpnI GATC 5 cut(s) 117, 121, 246, 341, 354
DpnII GATC 5 cut(s) 115, 119, 244, 339, 352
Eco130I CCWWGG 2 cut(s) 131, 408
Eco32I GATATC 1 cut(s) 502
Eco47I GGWCC 1 cut(s) 63
Eco57I CTGAAG 1 cut(s) 93
EcoRII CCWGG 1 cut(s) 175
EcoRV GATATC 1 cut(s) 502
EcoT14I CCWWGG 2 cut(s) 131, 408
EcoT22I ATGCAT 1 cut(s) 311
ErhI CCWWGG 2 cut(s) 131, 408
FaeI CATG 5 cut(s) 59, 106, 266, 313, 488
FatI CATG 5 cut(s) 55, 102, 262, 309, 484
FauNDI CATATG 1 cut(s) 349
FbaI TGATCA 1 cut(s) 352
FblI GTMKAC 2 cut(s) 30, 164
FokI GGATG 1 cut(s) 103
GlaI GCGC 2 cut(s) 252, 483
GsaI CCCAGC 1 cut(s) 339
HaeII RGCGCY 1 cut(s) 254
HgaI GACGC 1 cut(s) 16
HhaI GCGC 2 cut(s) 253, 484
Hin1II CATG 5 cut(s) 59, 106, 266, 313, 488
Hin6I GCGC 2 cut(s) 251, 482
HinP1I GCGC 2 cut(s) 251, 482
HincII GTYRAC 1 cut(s) 208
HindII GTYRAC 1 cut(s) 208
HinfI GANTC 1 cut(s) 180
Hpy166II GTNNAC 3 cut(s) 31, 165, 208
Hpy188I TCNGA 2 cut(s) 76, 479
Hpy188III TCNNGA 1 cut(s) 184
Hpy8I GTNNAC 3 cut(s) 31, 165, 208
HpyCH4III ACNGT 1 cut(s) 368
HpyCH4V TGCA 4 cut(s) 309, 324, 379, 488
HpyF3I CTNAG 3 cut(s) 75, 185, 476
Hsp92II CATG 5 cut(s) 59, 106, 266, 313, 488
HspAI GCGC 2 cut(s) 251, 482
Ksp22I TGATCA 1 cut(s) 352
Kzo9I GATC 5 cut(s) 115, 119, 244, 339, 352
LmnI GCTCC 1 cut(s) 293
MalI GATC 5 cut(s) 117, 121, 246, 341, 354
MboI GATC 5 cut(s) 115, 119, 244, 339, 352
MhlI GDGCHC 1 cut(s) 373
MluCI AATT 5 cut(s) 70, 200, 314, 387, 506
MmeI TCCRAC 1 cut(s) 422
MnlI CCTC 2 cut(s) 325, 505
Mph1103I ATGCAT 1 cut(s) 311
MseI TTAA 1 cut(s) 432
MslI CAYNNNNRTG 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 177
Mva1269I GAATGC 1 cut(s) 457
MvaI CCWGG 1 cut(s) 177
NdeI CATATG 1 cut(s) 349
NdeII GATC 5 cut(s) 115, 119, 244, 339, 352
NlaIII CATG 5 cut(s) 59, 106, 266, 313, 488
NsiI ATGCAT 1 cut(s) 311
NspI RCATGY 1 cut(s) 488
PaeI GCATGC 1 cut(s) 488
PctI GAATGC 1 cut(s) 457
PfeI GAWTC 1 cut(s) 180
PsiI TTATAA 1 cut(s) 297
Psp6I CCWGG 1 cut(s) 175
PspFI CCCAGC 1 cut(s) 335
PspGI CCWGG 1 cut(s) 175
PspPI GGNCC 1 cut(s) 63
RseI CAYNNNNRTG 1 cut(s) 38
SaqAI TTAA 1 cut(s) 432
Sau3AI GATC 5 cut(s) 115, 119, 244, 339, 352
Sau96I GGNCC 1 cut(s) 63
ScrFI CCNGG 1 cut(s) 177
SduI GDGCHC 1 cut(s) 373
SetI ASST 1 cut(s) 287
SfcI CTRYAG 1 cut(s) 364
SinI GGWCC 1 cut(s) 63
SmiMI CAYNNNNRTG 1 cut(s) 38
SphI GCATGC 1 cut(s) 488
Sse9I AATT 5 cut(s) 70, 200, 314, 387, 506
StyD4I CCNGG 1 cut(s) 175
StyI CCWWGG 2 cut(s) 131, 408
TaaI ACNGT 1 cut(s) 368
TaqI TCGA 2 cut(s) 118, 342
TasI AATT 5 cut(s) 70, 200, 314, 387, 506
TfiI GAWTC 1 cut(s) 180
Tru1I TTAA 1 cut(s) 432
Tru9I TTAA 1 cut(s) 432
TscAI CASTG 3 cut(s) 373, 381, 430
TspDTI ATGAA 2 cut(s) 107, 326
TspRI CASTG 3 cut(s) 373, 381, 430
VpaK11BI GGWCC 1 cut(s) 63
XapI RAATTY 2 cut(s) 70, 200
XceI RCATGY 1 cut(s) 488
XmiI GTMKAC 2 cut(s) 30, 164
Zsp2I ATGCAT 1 cut(s) 311
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.