MD11G1013200.v1.1

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
991477 .. 992826
1350 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1013200.v1.1.491

Sequence Viewer

Length: 201 bp
ATGTTCAATATAATTGAAATCAGTGATGAAGATATAATTCAAGCTCGTCGTCACTACACAAAGGCGTTGGTGGATGGAATCACTTATGATCTCTATGATGATGCCCATGTGCAAGGAGAGACGAAAGAGGAACCCTACATTTGTAAGATTGTGGAAATGTTTGAGGCAATTGGTGGTATATTATATTTTACTGCACAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.65

Weight (kDa)

4.35

Isoelectric Point (pI)

55.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 7, 17, 41
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
Alw26I GTCTC 1 cut(s) 113
BccI CCATC 1 cut(s) 68
BcoDI GTCTC 1 cut(s) 113
BmiI GGNNCC 1 cut(s) 132
BmsI GCATC 1 cut(s) 91
BseGI GGATG 1 cut(s) 79
BsgI GTGCAG 1 cut(s) 177
BsmAI GTCTC 1 cut(s) 113
BsmBI CGTCTC 1 cut(s) 113
Bsp143I GATC 1 cut(s) 88
BspLI GGNNCC 1 cut(s) 132
BssMI GATC 1 cut(s) 88
BstF5I GGATG 1 cut(s) 79
BstKTI GATC 1 cut(s) 91
BstMAI GTCTC 1 cut(s) 113
BstMBI GATC 1 cut(s) 88
BtsCI GGATG 1 cut(s) 79
BtsIMutI CAGTG 1 cut(s) 28
CviAII CATG 1 cut(s) 107
CviJI RGCY 1 cut(s) 44
CviKI_1 RGCY 1 cut(s) 44
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
Esp3I CGTCTC 1 cut(s) 113
FaeI CATG 1 cut(s) 110
FaiI YATR 7 cut(s) 11, 35, 87, 96, 108, 179, 184
FatI CATG 1 cut(s) 106
FokI GGATG 1 cut(s) 86
Hin1II CATG 1 cut(s) 110
HinfI GANTC 1 cut(s) 78
Hpy99I CGWCG 1 cut(s) 51
HpyCH4V TGCA 2 cut(s) 112, 194
Hsp92II CATG 1 cut(s) 110
Kzo9I GATC 1 cut(s) 88
LweI GCATC 1 cut(s) 91
MaeIII GTNAC 1 cut(s) 50
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MboII GAAGA 1 cut(s) 41
MfeI CAATTG 1 cut(s) 168
MluCI AATT 3 cut(s) 12, 36, 168
MnlI CCTC 2 cut(s) 121, 157
MunI CAATTG 1 cut(s) 168
NdeII GATC 1 cut(s) 88
NlaIII CATG 1 cut(s) 110
NlaIV GGNNCC 1 cut(s) 132
NmuCI GTSAC 1 cut(s) 50
PfeI GAWTC 1 cut(s) 78
PspN4I GGNNCC 1 cut(s) 132
Sau3AI GATC 1 cut(s) 88
SetI ASST 1 cut(s) 46
SfaNI GCATC 1 cut(s) 91
SgeI CNNG 4 cut(s) 53, 57, 119, 125
Sse9I AATT 3 cut(s) 12, 36, 168
TasI AATT 3 cut(s) 12, 36, 168
TfiI GAWTC 1 cut(s) 78
TscAI CASTG 1 cut(s) 28
TseFI GTSAC 1 cut(s) 50
Tsp45I GTSAC 1 cut(s) 50
TspDTI ATGAA 1 cut(s) 42
TspRI CASTG 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.