MD17G1160000.v1.1

Belongs to the terpene cyclase mutase family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
15578078 .. 15578893
816 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1160000.v1.1.491

Sequence Viewer

Length: 228 bp
ATGAGAATTCAGTTTTCAAAGGAGAATCCATGTGCCACTAATCTACCACAACTCAAAGTTAAAGATCAAGAAGAGGTGATGGAAGAGGCAGTGACAACCACATTACGAAGGGCTGTCAGTTTCTATTCAACAATCCAGGCGCATGACGGTCATTGGGCTGGGGATTATGGGGGTCCCATGTTTCTGCTTCCTGGTTTGGTAAGGGAGAAAATAGTAATGACTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.48

Weight (kDa)

6.05

Isoelectric Point (pI)

27.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 6
AgsI TTSAA 2 cut(s) 18, 129
AjnI CCWGG 2 cut(s) 135, 190
ApoI RAATTY 1 cut(s) 6
AspLEI GCGC 1 cut(s) 142
AspS9I GGNCC 1 cut(s) 173
AsuHPI GGTGA 1 cut(s) 88
AvaII GGWCC 1 cut(s) 173
BccI CCATC 1 cut(s) 73
BciT130I CCWGG 2 cut(s) 137, 192
Bme1390I CCNGG 2 cut(s) 137, 192
Bme18I GGWCC 1 cut(s) 173
BmgT120I GGNCC 1 cut(s) 173
BmiI GGNNCC 2 cut(s) 174, 175
BmrFI CCNGG 2 cut(s) 137, 192
BseBI CCWGG 2 cut(s) 137, 192
BseYI CCCAGC 1 cut(s) 158
BslFI GGGAC 1 cut(s) 159
BsmFI GGGAC 1 cut(s) 159
Bsp143I GATC 1 cut(s) 64
BspLI GGNNCC 2 cut(s) 174, 175
BssMI GATC 1 cut(s) 64
Bst2UI CCWGG 2 cut(s) 137, 192
Bst4CI ACNGT 2 cut(s) 149, 223
Bst6I CTCTTC 2 cut(s) 66, 78
BstHHI GCGC 1 cut(s) 142
BstKTI GATC 1 cut(s) 67
BstMBI GATC 1 cut(s) 64
BstNI CCWGG 2 cut(s) 137, 192
BstSCI CCNGG 2 cut(s) 135, 190
BtsI GCAGTG 1 cut(s) 96
BtsIMutI CAGTG 1 cut(s) 96
CfoI GCGC 1 cut(s) 142
Cfr13I GGNCC 1 cut(s) 173
CviAII CATG 3 cut(s) 30, 143, 178
CviJI RGCY 2 cut(s) 113, 158
CviKI_1 RGCY 2 cut(s) 113, 158
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
Eam1104I CTCTTC 2 cut(s) 66, 78
EarI CTCTTC 2 cut(s) 66, 78
Eco47I GGWCC 1 cut(s) 173
EcoO109I RGGNCCY 1 cut(s) 173
EcoRI GAATTC 1 cut(s) 6
EcoRII CCWGG 2 cut(s) 135, 190
FaeI CATG 3 cut(s) 33, 146, 181
FaiI YATR 4 cut(s) 31, 144, 168, 179
FaqI GGGAC 1 cut(s) 159
FatI CATG 3 cut(s) 29, 142, 177
GlaI GCGC 1 cut(s) 141
GsaI CCCAGC 1 cut(s) 162
HhaI GCGC 1 cut(s) 142
Hin1II CATG 3 cut(s) 33, 146, 181
Hin6I GCGC 1 cut(s) 140
HinP1I GCGC 1 cut(s) 140
HinfI GANTC 1 cut(s) 25
HphI GGTGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 68
HpyAV CCTTC 1 cut(s) 102
HpyCH4III ACNGT 2 cut(s) 149, 223
Hsp92II CATG 3 cut(s) 33, 146, 181
HspAI GCGC 1 cut(s) 140
KflI GGGWCCC 1 cut(s) 173
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 5 cut(s) 122, 144, 149, 177, 204
MaeIII GTNAC 1 cut(s) 91
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 2 cut(s) 83, 95
MluCI AATT 1 cut(s) 6
MnlI CCTC 2 cut(s) 67, 79
MseI TTAA 1 cut(s) 60
MspR9I CCNGG 2 cut(s) 137, 192
MvaI CCWGG 2 cut(s) 137, 192
NdeII GATC 1 cut(s) 64
NlaIII CATG 3 cut(s) 33, 146, 181
NlaIV GGNNCC 2 cut(s) 174, 175
NmuCI GTSAC 1 cut(s) 91
PfeI GAWTC 1 cut(s) 25
PpuMI RGGWCCY 1 cut(s) 173
Psp5II RGGWCCY 1 cut(s) 173
Psp6I CCWGG 2 cut(s) 135, 190
PspFI CCCAGC 1 cut(s) 158
PspGI CCWGG 2 cut(s) 135, 190
PspN4I GGNNCC 2 cut(s) 174, 175
PspPI GGNCC 1 cut(s) 173
PspPPI RGGWCCY 1 cut(s) 173
SaqAI TTAA 1 cut(s) 60
Sau3AI GATC 1 cut(s) 64
Sau96I GGNCC 1 cut(s) 173
ScrFI CCNGG 2 cut(s) 137, 192
SetI ASST 1 cut(s) 78
SgeI CNNG 9 cut(s) 42, 80, 148, 149, 155, 171, 190, 203, 204
SinI GGWCC 1 cut(s) 173
Sse9I AATT 1 cut(s) 6
StyD4I CCNGG 2 cut(s) 135, 190
TaaI ACNGT 2 cut(s) 149, 223
TasI AATT 1 cut(s) 6
TfiI GAWTC 1 cut(s) 25
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TscAI CASTG 1 cut(s) 96
TseFI GTSAC 1 cut(s) 91
Tsp45I GTSAC 1 cut(s) 91
TspRI CASTG 1 cut(s) 96
VpaK11BI GGWCC 1 cut(s) 173
XapI RAATTY 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.