pycom16g24410

Belongs to the terpene cyclase mutase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0001409
Physical Location & Seq
Forward (+)
25866230 .. 25866744
515 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g24410.1

Sequence Viewer

Length: 459 bp
ATGATACTGTGTTCTCCACTTGAGCTCTTTGGGTGTTTTTGTATAGAACCTATAGTTGTCGGGGTGTTCTATCCATCCTTGGAATTAGTTGGTTTCAAGCCAAATCGTGATTTGACGTTAACATATTTTATAACACTACTTTCCAATTTTTATGAACGTGTTTTCTTCTTATTTTTGAAATATAGTTTGCAAAGGAGAATCCATTTGCCACTAATCTACCACAACTCAAAAGTTAAAGATCAAGAAGAGGTGACAGAAGAGGCAGTGACAACCACATTACAAAGGTCTCTGAGTTTCTATTCAACAATCCAGGCACATGATGGACATTGGGCTAGGGATTATGGAGGTCCCATGTTTCTGCTTCCTAGTTTTGTAAGGGAGAAAAGTAGTAATCACTATGTAATCCAGAAGATGAAAACACAGAGAATCTATGTATCATGGTTAAAATATGAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00100 ko00909 ko01100 ko01110 map00100 map00909 map01100 map01110
Pfam Domains
Protein Families
SQHop_cyclase_C SQHop_cyclase_N

Protein Analysis

153

Amino Acids

18.01

Weight (kDa)

8.73

Isoelectric Point (pI)

48.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 131
AflIII ACRYGT 1 cut(s) 157
AgsI TTSAA 3 cut(s) 97, 178, 303
AjnI CCWGG 1 cut(s) 309
AluBI AGCT 1 cut(s) 25
AluI AGCT 1 cut(s) 25
Alw21I GWGCWC 1 cut(s) 27
Alw26I GTCTC 1 cut(s) 291
AspS9I GGNCC 1 cut(s) 347
AsuHPI GGTGA 1 cut(s) 262
AvaII GGWCC 1 cut(s) 347
BanII GRGCYC 1 cut(s) 27
Bbv12I GWGCWC 1 cut(s) 27
BccI CCATC 2 cut(s) 82, 314
BciT130I CCWGG 1 cut(s) 311
BcoDI GTCTC 1 cut(s) 291
BfaI CTAG 2 cut(s) 333, 366
BfmI CTRYAG 1 cut(s) 51
Bme1390I CCNGG 1 cut(s) 311
Bme18I GGWCC 1 cut(s) 347
BmgT120I GGNCC 1 cut(s) 347
BmiI GGNNCC 1 cut(s) 349
BmrFI CCNGG 1 cut(s) 311
BpuEI CTTGAG 1 cut(s) 41
BsaI GGTCTC 1 cut(s) 291
BsaJI CCNNGG 1 cut(s) 78
BseBI CCWGG 1 cut(s) 311
BseDI CCNNGG 1 cut(s) 78
BseGI GGATG 1 cut(s) 74
BseMII CTCAG 1 cut(s) 281
BsiHKAI GWGCWC 1 cut(s) 27
BslFI GGGAC 1 cut(s) 333
BsmAI GTCTC 1 cut(s) 291
BsmFI GGGAC 1 cut(s) 333
Bso31I GGTCTC 1 cut(s) 291
Bsp1286I GDGCHC 1 cut(s) 27
Bsp143I GATC 1 cut(s) 238
BspCNI CTCAG 1 cut(s) 282
BspLI GGNNCC 1 cut(s) 349
BspTNI GGTCTC 1 cut(s) 291
BssECI CCNNGG 1 cut(s) 78
BssMI GATC 1 cut(s) 238
BssT1I CCWWGG 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 311
Bst4CI ACNGT 1 cut(s) 9
Bst6I CTCTTC 2 cut(s) 240, 252
BstDEI CTNAG 1 cut(s) 290
BstF5I GGATG 1 cut(s) 74
BstKTI GATC 1 cut(s) 241
BstMAI GTCTC 1 cut(s) 291
BstMBI GATC 1 cut(s) 238
BstNI CCWGG 1 cut(s) 311
BstSCI CCNGG 1 cut(s) 309
BstSFI CTRYAG 1 cut(s) 51
BtsCI GGATG 1 cut(s) 74
BtsI GCAGTG 1 cut(s) 270
BtsIMutI CAGTG 1 cut(s) 270
Cfr13I GGNCC 1 cut(s) 347
CviAII CATG 3 cut(s) 317, 352, 438
CviJI RGCY 3 cut(s) 25, 100, 332
CviKI_1 RGCY 3 cut(s) 25, 100, 332
DdeI CTNAG 1 cut(s) 290
DpnI GATC 1 cut(s) 240
DpnII GATC 1 cut(s) 238
Eam1104I CTCTTC 2 cut(s) 240, 252
EarI CTCTTC 2 cut(s) 240, 252
Ecl136II GAGCTC 1 cut(s) 25
Eco130I CCWWGG 1 cut(s) 78
Eco24I GRGCYC 1 cut(s) 27
Eco31I GGTCTC 1 cut(s) 291
Eco47I GGWCC 1 cut(s) 347
Eco53kI GAGCTC 1 cut(s) 25
EcoICRI GAGCTC 1 cut(s) 25
EcoO109I RGGNCCY 1 cut(s) 347
EcoRII CCWGG 1 cut(s) 309
EcoT14I CCWWGG 1 cut(s) 78
EcoT38I GRGCYC 1 cut(s) 27
ErhI CCWWGG 1 cut(s) 78
FaeI CATG 3 cut(s) 320, 355, 441
FaqI GGGAC 1 cut(s) 333
FatI CATG 3 cut(s) 316, 351, 437
FokI GGATG 1 cut(s) 61
FriOI GRGCYC 1 cut(s) 27
FspBI CTAG 2 cut(s) 333, 366
Hin1II CATG 3 cut(s) 320, 355, 441
HincII GTYRAC 1 cut(s) 120
HindII GTYRAC 1 cut(s) 120
HinfI GANTC 2 cut(s) 198, 426
HpaI GTTAAC 1 cut(s) 120
HphI GGTGA 1 cut(s) 262
Hpy166II GTNNAC 1 cut(s) 120
Hpy188I TCNGA 1 cut(s) 291
Hpy188III TCNNGA 3 cut(s) 107, 242, 406
Hpy8I GTNNAC 1 cut(s) 120
HpyCH4III ACNGT 1 cut(s) 9
HpyCH4IV ACGT 2 cut(s) 116, 157
HpyCH4V TGCA 1 cut(s) 190
HpyF3I CTNAG 1 cut(s) 290
HpySE526I ACGT 2 cut(s) 116, 157
Hsp92II CATG 3 cut(s) 320, 355, 441
KspAI GTTAAC 1 cut(s) 120
Kzo9I GATC 1 cut(s) 238
LpnPI CCDG 3 cut(s) 296, 323, 419
MaeI CTAG 2 cut(s) 333, 366
MaeII ACGT 2 cut(s) 116, 157
MaeIII GTNAC 2 cut(s) 250, 265
MalI GATC 1 cut(s) 240
MboI GATC 1 cut(s) 238
MboII GAAGA 4 cut(s) 157, 257, 269, 421
MhlI GDGCHC 1 cut(s) 27
MluCI AATT 2 cut(s) 83, 145
MnlI CCTC 3 cut(s) 241, 253, 338
MseI TTAA 3 cut(s) 119, 234, 443
MspR9I CCNGG 1 cut(s) 311
MvaI CCWGG 1 cut(s) 311
NdeII GATC 1 cut(s) 238
NlaIII CATG 3 cut(s) 320, 355, 441
NlaIV GGNNCC 1 cut(s) 349
NmuCI GTSAC 2 cut(s) 250, 265
PfeI GAWTC 2 cut(s) 198, 426
PpuMI RGGWCCY 1 cut(s) 347
PsiI TTATAA 1 cut(s) 131
Psp124BI GAGCTC 1 cut(s) 27
Psp5II RGGWCCY 1 cut(s) 347
Psp6I CCWGG 1 cut(s) 309
PspGI CCWGG 1 cut(s) 309
PspN4I GGNNCC 1 cut(s) 349
PspPI GGNCC 1 cut(s) 347
PspPPI RGGWCCY 1 cut(s) 347
SacI GAGCTC 1 cut(s) 27
SaqAI TTAA 3 cut(s) 119, 234, 443
Sau3AI GATC 1 cut(s) 238
Sau96I GGNCC 1 cut(s) 347
ScrFI CCNGG 1 cut(s) 311
SduI GDGCHC 1 cut(s) 27
SetI ASST 7 cut(s) 27, 52, 119, 160, 252, 287, 349
SfcI CTRYAG 1 cut(s) 51
SinI GGWCC 1 cut(s) 347
SmlI CTYRAG 1 cut(s) 20
SmoI CTYRAG 1 cut(s) 20
Sse9I AATT 2 cut(s) 83, 145
SspMI CTAG 2 cut(s) 333, 366
SstI GAGCTC 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 309
StyI CCWWGG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 9
TaiI ACGT 2 cut(s) 119, 160
TasI AATT 2 cut(s) 83, 145
TfiI GAWTC 2 cut(s) 198, 426
Tru1I TTAA 3 cut(s) 119, 234, 443
Tru9I TTAA 3 cut(s) 119, 234, 443
TscAI CASTG 1 cut(s) 270
TseFI GTSAC 2 cut(s) 250, 265
Tsp45I GTSAC 2 cut(s) 250, 265
TspDTI ATGAA 2 cut(s) 168, 428
TspRI CASTG 1 cut(s) 270
VpaK11BI GGWCC 1 cut(s) 347
XcmI CCANNNNNNNNNTGG 1 cut(s) 317
XspI CTAG 2 cut(s) 333, 366
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.