RchiOBHm_Chr2g0148781

Belongs to the terpene cyclase mutase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
66560765 .. 66561160
396 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51830

Sequence Viewer

Length: 132 bp
ATGTTTCGACTTCCTGGTTTGGTTATTACACTTTCAATTGCAGGAGCTCTAAATGCTGTGTTATCCATAGAGCATCAACGGGAGATGTGTAGATATCTCTATACTCATCAGGCAAGAATATTACTCATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

43

Amino Acids

4.94

Weight (kDa)

9.3

Isoelectric Point (pI)

21.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 36
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
Alw21I GWGCWC 1 cut(s) 49
BanII GRGCYC 1 cut(s) 49
Bbv12I GWGCWC 1 cut(s) 49
BciT130I CCWGG 1 cut(s) 15
Bme1390I CCNGG 1 cut(s) 15
BmrFI CCNGG 1 cut(s) 15
BmsI GCATC 1 cut(s) 82
BseBI CCWGG 1 cut(s) 15
BsiHKAI GWGCWC 1 cut(s) 49
Bsp1286I GDGCHC 1 cut(s) 49
Bst2UI CCWGG 1 cut(s) 15
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
CviAII CATG 1 cut(s) 127
CviJI RGCY 1 cut(s) 47
CviKI_1 RGCY 1 cut(s) 47
Ecl136II GAGCTC 1 cut(s) 47
Eco24I GRGCYC 1 cut(s) 49
Eco32I GATATC 1 cut(s) 95
Eco53kI GAGCTC 1 cut(s) 47
EcoICRI GAGCTC 1 cut(s) 47
EcoRII CCWGG 1 cut(s) 13
EcoRV GATATC 1 cut(s) 95
EcoT38I GRGCYC 1 cut(s) 49
FaeI CATG 1 cut(s) 130
FaiI YATR 3 cut(s) 68, 102, 128
FatI CATG 1 cut(s) 126
FriOI GRGCYC 1 cut(s) 49
FspEI CC 7 cut(s) 5, 27, 27, 64, 65, 79, 95
Hin1II CATG 1 cut(s) 130
HpyCH4V TGCA 1 cut(s) 41
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
Hsp92II CATG 1 cut(s) 130
LmnI GCTCC 1 cut(s) 44
LpnPI CCDG 3 cut(s) 27, 27, 95
LweI GCATC 1 cut(s) 82
MfeI CAATTG 1 cut(s) 36
MhlI GDGCHC 1 cut(s) 49
MluCI AATT 1 cut(s) 36
MspR9I CCNGG 1 cut(s) 15
MunI CAATTG 1 cut(s) 36
MvaI CCWGG 1 cut(s) 15
MwoI GCNNNNNNNGC 1 cut(s) 53
NlaIII CATG 1 cut(s) 130
Psp124BI GAGCTC 1 cut(s) 49
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
SacI GAGCTC 1 cut(s) 49
ScrFI CCNGG 1 cut(s) 15
SduI GDGCHC 1 cut(s) 49
SetI ASST 1 cut(s) 49
SfaNI GCATC 1 cut(s) 82
SgeI CNNG 6 cut(s) 26, 27, 54, 92, 122, 126
Sse9I AATT 1 cut(s) 36
SspI AATATT 1 cut(s) 120
SstI GAGCTC 1 cut(s) 49
StyD4I CCNGG 1 cut(s) 13
TaqI TCGA 1 cut(s) 7
TasI AATT 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.