pycom12g18430

Hydrolyzes acetyl esters in homogalacturonan regions of pectin. In type I primary cell wall, galacturonic acid residues of pectin can be acetylated at the O-2 and O-3 positions. Decreasing the degree of acetylation of pectin gels in vitro alters their physical properties

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0001553
Physical Location & Seq
Forward (+)
20578970 .. 20579444
475 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g18430.1

Sequence Viewer

Length: 249 bp
ATGCAAATTCTGCAAGGATTCAGGAATCAAATGCTGAATGCAGTAAAACAATTCTCGGTGTCTAATCAAACTGGGATTTTCATAAATTCGTGTTTCGCGCACTGTCAAACAGGGCAAAGTGAATGGTTTTCACATGATTCTCCAGCTGTTGGAAACAAGACAATTGCAGAAGCTGTCGGAGATTGGTATTTTGATCGAGCGGAGGTTAAGGTTGTTGATGAAACTTGCCGCCATTTGGCTCTCAAATGA

Protein Analysis

83

Amino Acids

9.25

Weight (kDa)

6.24

Isoelectric Point (pI)

29.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PAE PF03283 1 - 76 2.7e-23 Pectinacetylesterase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 149
AccBSI CCGCTC 1 cut(s) 200
AccII CGCG 1 cut(s) 98
AciI CCGC 2 cut(s) 200, 229
AcsI RAATTY 2 cut(s) 6, 85
AfiI CCNNNNNNNGG 2 cut(s) 149, 235
AluBI AGCT 2 cut(s) 146, 173
AluI AGCT 2 cut(s) 146, 173
AlwNI CAGNNNCTG 1 cut(s) 173
ApoI RAATTY 2 cut(s) 6, 85
AspLEI GCGC 1 cut(s) 100
BisI GCNGC 1 cut(s) 229
BlsI GCNGC 1 cut(s) 230
BmrI ACTGGG 1 cut(s) 81
BmuI ACTGGG 1 cut(s) 81
BpmI CTGGAG 1 cut(s) 126
Bsc4I CCNNNNNNNGG 2 cut(s) 149, 235
Bse1I ACTGG 1 cut(s) 76
BseLI CCNNNNNNNGG 2 cut(s) 149, 235
BseNI ACTGG 1 cut(s) 76
Bsh1236I CGCG 1 cut(s) 98
BslI CCNNNNNNNGG 2 cut(s) 149, 235
BsmI GAATGC 1 cut(s) 43
Bsp143I GATC 1 cut(s) 193
BspACI CCGC 2 cut(s) 200, 229
BspFNI CGCG 1 cut(s) 98
BsrBI CCGCTC 1 cut(s) 200
BsrI ACTGG 1 cut(s) 76
BssMI GATC 1 cut(s) 193
Bst4CI ACNGT 1 cut(s) 104
BstAPI GCANNNNNTGC 1 cut(s) 10
BstFNI CGCG 1 cut(s) 98
BstHHI GCGC 1 cut(s) 100
BstKTI GATC 1 cut(s) 196
BstMBI GATC 1 cut(s) 193
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstUI CGCG 1 cut(s) 98
BtsIMutI CAGTG 1 cut(s) 100
CaiI CAGNNNCTG 1 cut(s) 173
CfoI GCGC 1 cut(s) 100
CviAII CATG 1 cut(s) 134
CviJI RGCY 3 cut(s) 146, 173, 239
CviKI_1 RGCY 3 cut(s) 146, 173, 239
DpnI GATC 1 cut(s) 195
DpnII GATC 1 cut(s) 193
FaeI CATG 1 cut(s) 137
FaiI YATR 2 cut(s) 83, 135
FatI CATG 1 cut(s) 133
Fnu4HI GCNGC 1 cut(s) 229
Fsp4HI GCNGC 1 cut(s) 229
GlaI GCGC 1 cut(s) 99
GluI GCNGC 1 cut(s) 229
GsuI CTGGAG 1 cut(s) 126
HhaI GCGC 1 cut(s) 100
Hin1II CATG 1 cut(s) 137
Hin6I GCGC 1 cut(s) 98
HinP1I GCGC 1 cut(s) 98
HinfI GANTC 3 cut(s) 18, 25, 137
Hpy188I TCNGA 1 cut(s) 179
Hpy188III TCNNGA 1 cut(s) 22
HpyCH4III ACNGT 1 cut(s) 104
HpyCH4V TGCA 4 cut(s) 4, 13, 41, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
Hsp92II CATG 1 cut(s) 137
HspAI GCGC 1 cut(s) 98
Kzo9I GATC 1 cut(s) 193
LpnPI CCDG 4 cut(s) 7, 57, 96, 156
MalI GATC 1 cut(s) 195
MbiI CCGCTC 1 cut(s) 200
MboI GATC 1 cut(s) 193
MfeI CAATTG 1 cut(s) 162
MluCI AATT 4 cut(s) 6, 50, 85, 162
MmeI TCCRAC 2 cut(s) 130, 157
MnlI CCTC 1 cut(s) 196
MseI TTAA 1 cut(s) 207
MspA1I CMGCKG 1 cut(s) 146
MunI CAATTG 1 cut(s) 162
Mva1269I GAATGC 1 cut(s) 43
MvnI CGCG 1 cut(s) 98
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeII GATC 1 cut(s) 193
NlaIII CATG 1 cut(s) 137
PctI GAATGC 1 cut(s) 43
PfeI GAWTC 3 cut(s) 18, 25, 137
PflMI CCANNNNNTGG 1 cut(s) 149
PkrI GCNGC 1 cut(s) 230
PstNI CAGNNNCTG 1 cut(s) 173
PvuII CAGCTG 1 cut(s) 146
SaqAI TTAA 1 cut(s) 207
SatI GCNGC 1 cut(s) 229
Sau3AI GATC 1 cut(s) 193
SetI ASST 4 cut(s) 148, 175, 207, 213
Sse9I AATT 4 cut(s) 6, 50, 85, 162
SsiI CCGC 2 cut(s) 200, 229
TaaI ACNGT 1 cut(s) 104
TaqI TCGA 1 cut(s) 196
TasI AATT 4 cut(s) 6, 50, 85, 162
TauI GCSGC 1 cut(s) 231
TfiI GAWTC 3 cut(s) 18, 25, 137
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TscAI CASTG 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 70, 234
TspRI CASTG 1 cut(s) 107
Van91I CCANNNNNTGG 1 cut(s) 149
XapI RAATTY 2 cut(s) 6, 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.