pycom12g18480

Hydrolyzes acetyl esters in homogalacturonan regions of pectin. In type I primary cell wall, galacturonic acid residues of pectin can be acetylated at the O-2 and O-3 positions. Decreasing the degree of acetylation of pectin gels in vitro alters their physical properties

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
20616948 .. 20617207
260 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGTTTAATGTTATCTCGTGTGGACTATCGCAGACAATCGCAGAAGCGGTTGGAGATTGGTATTTCGATCGGGCGGAAGTTAAGGTTGTCAATGAATCTTACTACGGGCTGGTTTGGTATTGTTGTGCTTTGAAAAAAAACTGCTTCTGCTGTGCTGTGAGAATAAGCAGCTGTGAAATAAAGCAGCAGAGTGTTTGGTAA

Protein Analysis

67

Amino Acids

7.56

Weight (kDa)

6.07

Isoelectric Point (pI)

39.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 47, 74
AgsI TTSAA 1 cut(s) 133
AluBI AGCT 1 cut(s) 171
AluI AGCT 1 cut(s) 171
ApeKI GCWGC 2 cut(s) 168, 184
BauI CACGAG 1 cut(s) 16
BbvI GCAGC 2 cut(s) 180, 196
BisI GCNGC 2 cut(s) 169, 185
BlsI GCNGC 2 cut(s) 170, 186
BseXI GCAGC 2 cut(s) 180, 196
Bsh1285I CGRYCG 1 cut(s) 70
BsiEI CGRYCG 1 cut(s) 70
Bsp143I GATC 1 cut(s) 67
BspACI CCGC 2 cut(s) 47, 74
BssMI GATC 1 cut(s) 67
BssSI CACGAG 1 cut(s) 16
Bst2BI CACGAG 1 cut(s) 16
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
BstMCI CGRYCG 1 cut(s) 70
BstV1I GCAGC 2 cut(s) 180, 196
CviJI RGCY 2 cut(s) 109, 171
CviKI_1 RGCY 2 cut(s) 109, 171
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
EciI GGCGGA 1 cut(s) 89
Fnu4HI GCNGC 2 cut(s) 169, 185
Fsp4HI GCNGC 2 cut(s) 169, 185
GluI GCNGC 2 cut(s) 169, 185
HinfI GANTC 1 cut(s) 95
Hpy166II GTNNAC 1 cut(s) 23
Hpy8I GTNNAC 1 cut(s) 23
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 1 cut(s) 95
Lsp1109I GCAGC 2 cut(s) 180, 196
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MmeI TCCRAC 1 cut(s) 31
MseI TTAA 2 cut(s) 6, 81
MspA1I CMGCKG 1 cut(s) 171
NdeII GATC 1 cut(s) 67
PfeI GAWTC 1 cut(s) 95
PkrI GCNGC 2 cut(s) 170, 186
Ple19I CGATCG 1 cut(s) 70
PvuI CGATCG 1 cut(s) 70
PvuII CAGCTG 1 cut(s) 171
SaqAI TTAA 2 cut(s) 6, 81
SatI GCNGC 2 cut(s) 169, 185
Sau3AI GATC 1 cut(s) 67
SetI ASST 2 cut(s) 87, 173
SgeI CNNG 5 cut(s) 28, 30, 83, 118, 122
SsiI CCGC 2 cut(s) 47, 74
TaqI TCGA 1 cut(s) 66
TfiI GAWTC 1 cut(s) 95
Tru1I TTAA 2 cut(s) 6, 81
Tru9I TTAA 2 cut(s) 6, 81
TseI GCWGC 2 cut(s) 168, 184
TspDTI ATGAA 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.