RchiOBHm_Chr5g0078081

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
83961063 .. 83962371
1309 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 150 bp
ATGCCTCAAGATTTGCCGTCGGATCAGGAAGCAGACGATGCCGGAGCTGAGTTCACTAAGGTTGATCTCATTGGTCGTTACGGACGGTATATAGAGGTTCATCAAGAAAGTGTATCCTTTTTGCTCTGTTCTTTGTCAAAGTCTCATTGA

Protein Analysis

49

Amino Acids

5.48

Weight (kDa)

4.55

Isoelectric Point (pI)

42.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 30
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
AlwI GGATC 1 cut(s) 30
BciVI GTATCC 1 cut(s) 124
BfuI GTATCC 1 cut(s) 124
BmsI GCATC 1 cut(s) 28
BseMII CTCAG 1 cut(s) 39
BsiSI CCGG 1 cut(s) 42
Bsp143I GATC 2 cut(s) 22, 64
BspCNI CTCAG 1 cut(s) 40
BspPI GGATC 1 cut(s) 30
BssMI GATC 2 cut(s) 22, 64
Bst4CI ACNGT 1 cut(s) 87
BstAPI GCANNNNNTGC 1 cut(s) 38
BstDEI CTNAG 2 cut(s) 48, 57
BstKTI GATC 2 cut(s) 25, 67
BstMBI GATC 2 cut(s) 22, 64
BstMWI GCNNNNNNNGC 1 cut(s) 38
BsuI GTATCC 1 cut(s) 124
CviJI RGCY 1 cut(s) 47
CviKI_1 RGCY 1 cut(s) 47
DdeI CTNAG 2 cut(s) 48, 57
DpnI GATC 2 cut(s) 24, 66
DpnII GATC 2 cut(s) 22, 64
FaiI YATR 2 cut(s) 90, 92
HapII CCGG 1 cut(s) 42
HpaII CCGG 1 cut(s) 42
Hpy166II GTNNAC 1 cut(s) 54
Hpy188I TCNGA 1 cut(s) 22
Hpy188III TCNNGA 3 cut(s) 8, 26, 104
Hpy8I GTNNAC 1 cut(s) 54
Hpy99I CGWCG 1 cut(s) 22
HpyCH4III ACNGT 1 cut(s) 87
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpyF3I CTNAG 2 cut(s) 48, 57
Kzo9I GATC 2 cut(s) 22, 64
LmnI GCTCC 1 cut(s) 44
LpnPI CCDG 2 cut(s) 11, 55
LweI GCATC 1 cut(s) 28
MaeIII GTNAC 1 cut(s) 77
MalI GATC 2 cut(s) 24, 66
MboI GATC 2 cut(s) 22, 64
MnlI CCTC 2 cut(s) 15, 88
MspI CCGG 1 cut(s) 42
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeII GATC 2 cut(s) 22, 64
Sau3AI GATC 2 cut(s) 22, 64
SetI ASST 3 cut(s) 49, 63, 99
SfaNI GCATC 1 cut(s) 28
SgeI CNNG 4 cut(s) 20, 38, 54, 116
SmlI CTYRAG 1 cut(s) 6
SmoI CTYRAG 1 cut(s) 6
TaaI ACNGT 1 cut(s) 87
TspDTI ATGAA 1 cut(s) 89
TspGWI ACGGA 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.