Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0002870

Physical Location & Seq

Genomic Coordinates Forward (+)

8109423 .. 8110273

Gene Structure 851 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00006080.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 174 bp

ATGCCCGAAGATTTGCCGTCGGATCGGGAAGCGGACGATGGTGAAGCCGAGTTCAATAAGGTTGATCTCACCTGGTTGTTACGGACGGAGCATATAGAGGTTTTAGGCAAAGGAGCTTTCAAGAAAGTGTATCCTTTTTGCTCGTTCTTTGTCAAAGTTTCATTGATGGGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0023052 GO:0035556 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

OSR1_C Pkinase

Protein Analysis

57

Amino Acids

6.51

Weight (kDa)

4.72

Isoelectric Point (pI)

40.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002870)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g07560
malus_domestica	MD07G1154000.v1.1
pyrus_communis	pycom14g14260 pycom16g16290
rosa_chinensis	RchiOBHm_Chr3g0469611 RchiOBHm_Chr5g0078081 RchiOBHm_Chr7g0208181
rosa_laevigata	RLG00000033831
rosa_multiflora	Rmu_co8062676.1_g000002 Rmu_sc0003108.1_g000027 Rmu_sc0006483.1_g000012 Rmu_sc0018944.1_g000001 Rmu_sc0022000.1_g000001 Rmu_sc0034052.1_g000001 Rmu_sc0041954.1_g000001
rosa_roxburghii	Rroxscaffold_1G00000580 Rroxscaffold_1G00006080 Rroxscaffold_1G00008040 Rroxscaffold_1G00008480 Rroxscaffold_1G00025750 Rroxscaffold_1G00025970 Rroxscaffold_1G00030650 Rroxscaffold_2G00092550 Rroxscaffold_3G00237550 Rroxscaffold_3G00245300 Rroxscaffold_4G00312850 Rroxscaffold_4G00312880 Rroxscaffold_4G00332520 Rroxscaffold_6G00411430
rosa_rugosa	Rorug06G0481400
rosa_samantha	Rh1CG136900 Rh2AG496900 Rh2CG482900 Rh3AG152300 Rh3CG167100 Rh5CG471900 Rh5CG472000 Rh7DG242000
rosa_wichuraiana	Rw7G010120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	32
AclWI	GGATC	1 cut(s)	30
AgsI	TTSAA	2 cut(s)	55, 121
AjnI	CCWGG	1 cut(s)	71
AluBI	AGCT	1 cut(s)	116
AluI	AGCT	1 cut(s)	116
AlwI	GGATC	1 cut(s)	30
AsuHPI	GGTGA	2 cut(s)	53, 61
BccI	CCATC	2 cut(s)	32, 160
BciT130I	CCWGG	1 cut(s)	73
BciVI	GTATCC	1 cut(s)	141
BfuI	GTATCC	1 cut(s)	141
Bme1390I	CCNGG	1 cut(s)	73
BmrFI	CCNGG	1 cut(s)	73
BseBI	CCWGG	1 cut(s)	73
Bsp143I	GATC	2 cut(s)	22, 64
BspACI	CCGC	1 cut(s)	32
BspPI	GGATC	1 cut(s)	30
BssMI	GATC	2 cut(s)	22, 64
Bst2UI	CCWGG	1 cut(s)	73
BstKTI	GATC	2 cut(s)	25, 67
BstMBI	GATC	2 cut(s)	22, 64
BstNI	CCWGG	1 cut(s)	73
BstSCI	CCNGG	1 cut(s)	71
BsuI	GTATCC	1 cut(s)	141
CsiI	ACCWGGT	1 cut(s)	71
CviJI	RGCY	2 cut(s)	47, 116
CviKI_1	RGCY	2 cut(s)	47, 116
DpnI	GATC	2 cut(s)	24, 66
DpnII	GATC	2 cut(s)	22, 64
EcoRII	CCWGG	1 cut(s)	71
FaiI	YATR	2 cut(s)	93, 95
HphI	GGTGA	2 cut(s)	53, 61
Hpy188I	TCNGA	1 cut(s)	22
Hpy188III	TCNNGA	2 cut(s)	26, 121
Hpy99I	CGWCG	1 cut(s)	22
Kzo9I	GATC	2 cut(s)	22, 64
LmnI	GCTCC	2 cut(s)	88, 113
LpnPI	CCDG	2 cut(s)	58, 85
MabI	ACCWGGT	1 cut(s)	71
MaeIII	GTNAC	1 cut(s)	78
MalI	GATC	2 cut(s)	24, 66
MboI	GATC	2 cut(s)	22, 64
MboII	GAAGA	1 cut(s)	20
MnlI	CCTC	1 cut(s)	91
MspR9I	CCNGG	1 cut(s)	73
MvaI	CCWGG	1 cut(s)	73
NdeII	GATC	2 cut(s)	22, 64
NmeAIII	GCCGAG	1 cut(s)	73
Psp6I	CCWGG	1 cut(s)	71
PspGI	CCWGG	1 cut(s)	71
Sau3AI	GATC	2 cut(s)	22, 64
ScrFI	CCNGG	1 cut(s)	73
SetI	ASST	4 cut(s)	63, 74, 102, 118
SexAI	ACCWGGT	1 cut(s)	71
SgeI	CNNG	7 cut(s)	17, 38, 61, 84, 85, 133, 154
SsiI	CCGC	1 cut(s)	32
StyD4I	CCNGG	1 cut(s)	71
TspDTI	ATGAA	1 cut(s)	150
TspGWI	ACGGA	2 cut(s)	97, 101

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.