Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000003

Orthogroup ID

OG0002870

Physical Location & Seq

Genomic Coordinates Forward (+)

25246926 .. 25248459

Gene Structure 1534 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_3G00237550.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 372 bp

ATGGAAAGTGATAGTAAACGAGTTACCTCTTGGGTTGTTGGGGATTACCCTAATGTAGCAGATTTATGGGAGCTTGGTTCCTTTTCTTTCGGTGTGGGACGCTCGGGGTTCCCGATATCGCCCCAACGGATATCGGGACCCTCGGCTGGGAGCTTACCTCGCCTGTGTATTGGACATACGAGTCTTGTGCTTCCGATACTTGCACAGGGAGAGATTTTGAGTGGGCACCTAGGTGGTGTGGGGCCTAAGCGTTTTGGGCATGTCCGGCTTATAAGAATTTTATATATATATATATATATATATATATATATATATATATATATTACTAAATACTTGTTACTCCTCATACTTTTGCCTAAAAAACGAGTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

123

Amino Acids

13.74

Weight (kDa)

9.76

Isoelectric Point (pI)

43.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002870)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g07560
malus_domestica	MD07G1154000.v1.1
pyrus_communis	pycom14g14260 pycom16g16290
rosa_chinensis	RchiOBHm_Chr3g0469611 RchiOBHm_Chr5g0078081 RchiOBHm_Chr7g0208181
rosa_laevigata	RLG00000033831
rosa_multiflora	Rmu_co8062676.1_g000002 Rmu_sc0003108.1_g000027 Rmu_sc0006483.1_g000012 Rmu_sc0018944.1_g000001 Rmu_sc0022000.1_g000001 Rmu_sc0034052.1_g000001 Rmu_sc0041954.1_g000001
rosa_roxburghii	Rroxscaffold_1G00000580 Rroxscaffold_1G00006080 Rroxscaffold_1G00008040 Rroxscaffold_1G00008480 Rroxscaffold_1G00025750 Rroxscaffold_1G00025970 Rroxscaffold_1G00030650 Rroxscaffold_2G00092550 Rroxscaffold_3G00237550 Rroxscaffold_3G00245300 Rroxscaffold_4G00312850 Rroxscaffold_4G00312880 Rroxscaffold_4G00332520 Rroxscaffold_6G00411430
rosa_rugosa	Rorug06G0481400
rosa_samantha	Rh1CG136900 Rh2AG496900 Rh2CG482900 Rh3AG152300 Rh3CG167100 Rh5CG471900 Rh5CG472000 Rh7DG242000
rosa_wichuraiana	Rw7G010120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	272
AasI	GACNNNNNNGTC	1 cut(s)	180
AccB1I	GGYRCC	1 cut(s)	225
AcsI	RAATTY	1 cut(s)	276
AfiI	CCNNNNNNNGG	2 cut(s)	146, 147
AleI	CACNNNNGTG	1 cut(s)	231
AluBI	AGCT	2 cut(s)	73, 153
AluI	AGCT	2 cut(s)	73, 153
Ama87I	CYCGRG	1 cut(s)	103
AoxI	GGCC	1 cut(s)	242
ApoI	RAATTY	1 cut(s)	276
AspA2I	CCTAGG	1 cut(s)	229
AspS9I	GGNCC	2 cut(s)	137, 242
AvaI	CYCGRG	1 cut(s)	103
AvaII	GGWCC	1 cut(s)	137
AvrII	CCTAGG	1 cut(s)	229
BaeGI	GKGCMC	1 cut(s)	228
BanI	GGYRCC	1 cut(s)	225
BcgI	CGANNNNNNTGC	2 cut(s)	169, 203
BfaI	CTAG	1 cut(s)	230
BlnI	CCTAGG	1 cut(s)	229
Bme18I	GGWCC	1 cut(s)	137
BmeT110I	CYCGRG	1 cut(s)	103
BmgT120I	GGNCC	2 cut(s)	137, 242
BmiI	GGNNCC	6 cut(s)	79, 110, 138, 139, 227, 243
BplI	GAGNNNNNCTC	2 cut(s)	142, 174
Bpu10I	CCTNAGC	1 cut(s)	246
BsaJI	CCNNGG	2 cut(s)	141, 229
Bsc4I	CCNNNNNNNGG	2 cut(s)	146, 147
BseDI	CCNNGG	2 cut(s)	141, 229
BseLI	CCNNNNNNNGG	2 cut(s)	146, 147
BseRI	GAGGAG	1 cut(s)	332
BseSI	GKGCMC	1 cut(s)	228
BseYI	CCCAGC	1 cut(s)	146
BshFI	GGCC	1 cut(s)	244
BshNI	GGYRCC	1 cut(s)	225
BsiHKCI	CYCGRG	1 cut(s)	103
BsiSI	CCGG	1 cut(s)	265
BslFI	GGGAC	2 cut(s)	111, 150
BslI	CCNNNNNNNGG	2 cut(s)	146, 147
BsmFI	GGGAC	2 cut(s)	111, 150
BsnI	GGCC	1 cut(s)	244
BsoBI	CYCGRG	1 cut(s)	103
Bsp1286I	GDGCHC	1 cut(s)	228
BspANI	GGCC	1 cut(s)	244
BspLI	GGNNCC	6 cut(s)	79, 110, 138, 139, 227, 243
BspT107I	GGYRCC	1 cut(s)	225
BssECI	CCNNGG	2 cut(s)	141, 229
BssT1I	CCWWGG	1 cut(s)	229
BstDEI	CTNAG	1 cut(s)	246
BstMWI	GCNNNNNNNGC	3 cut(s)	159, 256, 265
BstNSI	RCATGY	1 cut(s)	263
BstSLI	GKGCMC	1 cut(s)	228
BsuRI	GGCC	1 cut(s)	244
Cfr13I	GGNCC	2 cut(s)	137, 242
CseI	GACGC	1 cut(s)	108
CviAII	CATG	1 cut(s)	260
CviJI	RGCY	5 cut(s)	73, 146, 153, 244, 268
CviKI_1	RGCY	5 cut(s)	73, 146, 153, 244, 268
DdeI	CTNAG	1 cut(s)	246
DrdI	GACNNNNNNGTC	1 cut(s)	180
DseDI	GACNNNNNNGTC	1 cut(s)	180
Eco130I	CCWWGG	1 cut(s)	229
Eco32I	GATATC	2 cut(s)	117, 132
Eco47I	GGWCC	1 cut(s)	137
Eco88I	CYCGRG	1 cut(s)	103
EcoO109I	RGGNCCY	2 cut(s)	137, 242
EcoRV	GATATC	2 cut(s)	117, 132
EcoT14I	CCWWGG	1 cut(s)	229
ErhI	CCWWGG	1 cut(s)	229
FaeI	CATG	1 cut(s)	263
FaqI	GGGAC	2 cut(s)	111, 150
FatI	CATG	1 cut(s)	259
FspBI	CTAG	1 cut(s)	230
GsaI	CCCAGC	1 cut(s)	150
HaeIII	GGCC	1 cut(s)	244
HapII	CCGG	1 cut(s)	265
HgaI	GACGC	1 cut(s)	108
Hin1II	CATG	1 cut(s)	263
HinfI	GANTC	1 cut(s)	181
HpaII	CCGG	1 cut(s)	265
Hpy166II	GTNNAC	1 cut(s)	17
Hpy188I	TCNGA	1 cut(s)	195
Hpy188III	TCNNGA	2 cut(s)	112, 135
Hpy8I	GTNNAC	1 cut(s)	17
HpyCH4V	TGCA	1 cut(s)	203
HpyF10VI	GCNNNNNNNGC	3 cut(s)	159, 256, 265
HpyF3I	CTNAG	1 cut(s)	246
Hsp92II	CATG	1 cut(s)	263
KflI	GGGWCCC	1 cut(s)	137
LmnI	GCTCC	2 cut(s)	70, 150
LpnPI	CCDG	4 cut(s)	132, 176, 191, 278
MaeI	CTAG	1 cut(s)	230
MaeIII	GTNAC	2 cut(s)	22, 336
MhlI	GDGCHC	1 cut(s)	228
MluCI	AATT	1 cut(s)	276
MlyI	GAGTC	1 cut(s)	190
MnlI	CCTC	4 cut(s)	37, 151, 168, 353
MslI	CAYNNNNRTG	1 cut(s)	231
MspI	CCGG	1 cut(s)	265
MwoI	GCNNNNNNNGC	3 cut(s)	159, 256, 265
NlaIII	CATG	1 cut(s)	263
NlaIV	GGNNCC	6 cut(s)	79, 110, 138, 139, 227, 243
NmeAIII	GCCGAG	1 cut(s)	122
NspI	RCATGY	1 cut(s)	263
OliI	CACNNNNGTG	1 cut(s)	231
PcsI	WCGNNNNNNNCGW	1 cut(s)	110
PleI	GAGTC	1 cut(s)	189
PpsI	GAGTC	1 cut(s)	189
PpuMI	RGGWCCY	1 cut(s)	137
PsiI	TTATAA	1 cut(s)	272
Psp5II	RGGWCCY	1 cut(s)	137
PspFI	CCCAGC	1 cut(s)	146
PspN4I	GGNNCC	6 cut(s)	79, 110, 138, 139, 227, 243
PspPI	GGNCC	2 cut(s)	137, 242
PspPPI	RGGWCCY	1 cut(s)	137
RseI	CAYNNNNRTG	1 cut(s)	231
Sau96I	GGNCC	2 cut(s)	137, 242
SchI	GAGTC	1 cut(s)	190
SduI	GDGCHC	1 cut(s)	228
SetI	ASST	6 cut(s)	29, 75, 155, 160, 231, 235
SinI	GGWCC	1 cut(s)	137
SmiMI	CAYNNNNRTG	1 cut(s)	231
Sse9I	AATT	1 cut(s)	276
SspMI	CTAG	1 cut(s)	230
StyI	CCWWGG	1 cut(s)	229
TasI	AATT	1 cut(s)	276
TspGWI	ACGGA	1 cut(s)	142
VpaK11BI	GGWCC	1 cut(s)	137
XapI	RAATTY	1 cut(s)	276
XceI	RCATGY	1 cut(s)	263
XmaJI	CCTAGG	1 cut(s)	229
XspI	CTAG	1 cut(s)	230

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.