Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5C

Orthogroup ID

OG0002870

Physical Location & Seq

Genomic Coordinates Reverse (-)

65732125 .. 65732504

Gene Structure 380 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5CG472000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGCCTGAAGATTTGCCGTCGGATCAGGAAGCGGACGATGATGAAGCTGAGTTCACTAAGGTTGATCTCACTGGTTGTTACGGACGGAGGTCAGTTCATATAGAGGTTTTAGGCAAAGGAGCTTTCAAGAAAGTGTATCCTTTTTGCTCTGTTCTTTGTCAACGTTTCATTGATGGGTTGATGAATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0023052 GO:0035556 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

OSR1_C Pkinase

Protein Analysis

62

Amino Acids

6.99

Weight (kDa)

4.54

Isoelectric Point (pI)

49.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002870)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g07560
malus_domestica	MD07G1154000.v1.1
pyrus_communis	pycom14g14260 pycom16g16290
rosa_chinensis	RchiOBHm_Chr3g0469611 RchiOBHm_Chr5g0078081 RchiOBHm_Chr7g0208181
rosa_laevigata	RLG00000033831
rosa_multiflora	Rmu_co8062676.1_g000002 Rmu_sc0003108.1_g000027 Rmu_sc0006483.1_g000012 Rmu_sc0018944.1_g000001 Rmu_sc0022000.1_g000001 Rmu_sc0034052.1_g000001 Rmu_sc0041954.1_g000001
rosa_roxburghii	Rroxscaffold_1G00000580 Rroxscaffold_1G00006080 Rroxscaffold_1G00008040 Rroxscaffold_1G00008480 Rroxscaffold_1G00025750 Rroxscaffold_1G00025970 Rroxscaffold_1G00030650 Rroxscaffold_2G00092550 Rroxscaffold_3G00237550 Rroxscaffold_3G00245300 Rroxscaffold_4G00312850 Rroxscaffold_4G00312880 Rroxscaffold_4G00332520 Rroxscaffold_6G00411430
rosa_rugosa	Rorug06G0481400
rosa_samantha	Rh1CG136900 Rh2AG496900 Rh2CG482900 Rh3AG152300 Rh3CG167100 Rh5CG471900 Rh5CG472000 Rh7DG242000
rosa_wichuraiana	Rw7G010120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	32
AclI	AACGTT	1 cut(s)	163
AclWI	GGATC	1 cut(s)	30
AcuI	CTGAAG	1 cut(s)	27
AgsI	TTSAA	1 cut(s)	127
AluBI	AGCT	2 cut(s)	47, 122
AluI	AGCT	2 cut(s)	47, 122
AlwI	GGATC	1 cut(s)	30
BccI	CCATC	1 cut(s)	167
BciVI	GTATCC	1 cut(s)	147
BfuI	GTATCC	1 cut(s)	147
BoxI	GACNNNNGTC	1 cut(s)	88
Bse1I	ACTGG	1 cut(s)	76
BseMII	CTCAG	1 cut(s)	39
BseNI	ACTGG	1 cut(s)	76
Bsp143I	GATC	2 cut(s)	22, 64
BspACI	CCGC	1 cut(s)	32
BspCNI	CTCAG	1 cut(s)	40
BspPI	GGATC	1 cut(s)	30
BsrI	ACTGG	1 cut(s)	76
BssMI	GATC	2 cut(s)	22, 64
BstDEI	CTNAG	2 cut(s)	48, 57
BstKTI	GATC	2 cut(s)	25, 67
BstMBI	GATC	2 cut(s)	22, 64
BstPAI	GACNNNNGTC	1 cut(s)	88
BsuI	GTATCC	1 cut(s)	147
BtsIMutI	CAGTG	1 cut(s)	69
CviJI	RGCY	2 cut(s)	47, 122
CviKI_1	RGCY	2 cut(s)	47, 122
DdeI	CTNAG	2 cut(s)	48, 57
DpnI	GATC	2 cut(s)	24, 66
DpnII	GATC	2 cut(s)	22, 64
Eco57I	CTGAAG	1 cut(s)	27
FaiI	YATR	2 cut(s)	99, 101
HincII	GTYRAC	1 cut(s)	161
HindII	GTYRAC	1 cut(s)	161
Hpy166II	GTNNAC	2 cut(s)	54, 161
Hpy188I	TCNGA	1 cut(s)	22
Hpy188III	TCNNGA	2 cut(s)	26, 127
Hpy8I	GTNNAC	2 cut(s)	54, 161
Hpy99I	CGWCG	1 cut(s)	22
HpyCH4IV	ACGT	1 cut(s)	163
HpyF3I	CTNAG	2 cut(s)	48, 57
HpySE526I	ACGT	1 cut(s)	163
Kzo9I	GATC	2 cut(s)	22, 64
LmnI	GCTCC	1 cut(s)	119
LpnPI	CCDG	3 cut(s)	11, 18, 57
MaeII	ACGT	1 cut(s)	163
MaeIII	GTNAC	1 cut(s)	77
MalI	GATC	2 cut(s)	24, 66
MboI	GATC	2 cut(s)	22, 64
MboII	GAAGA	1 cut(s)	20
MluCI	AATT	1 cut(s)	184
MnlI	CCTC	2 cut(s)	81, 97
NdeII	GATC	2 cut(s)	22, 64
PshAI	GACNNNNGTC	1 cut(s)	88
Psp1406I	AACGTT	1 cut(s)	163
Sau3AI	GATC	2 cut(s)	22, 64
SetI	ASST	6 cut(s)	49, 63, 92, 108, 124, 166
SgeI	CNNG	4 cut(s)	17, 38, 84, 139
Sse9I	AATT	1 cut(s)	184
SsiI	CCGC	1 cut(s)	32
TaiI	ACGT	1 cut(s)	166
TasI	AATT	1 cut(s)	184
TscAI	CASTG	1 cut(s)	76
TspDTI	ATGAA	3 cut(s)	57, 86, 157
TspGWI	ACGGA	2 cut(s)	96, 100
TspRI	CASTG	1 cut(s)	76

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.