Rh7DG242000

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
24937440 .. 24937817
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG242000.1

Sequence Viewer

Length: 180 bp
ATGCCTCAAGATTTTCCGTCGGATCAGGAAGCGGACGATGCCGAATCTGAGTTCACTAGGGTTGATCTCACTGGTCGTTACGGACGGTATATAGAGGTTTTAGGCAAAGGGGCTTTGAAGGAAGTGTATCCTTTTTGCTCTGTTCTTTGTCAAAGTTTCATTGATGGGTTGATGAATTGA

Protein Analysis

59

Amino Acids

6.65

Weight (kDa)

4.18

Isoelectric Point (pI)

41.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 32
AclWI GGATC 1 cut(s) 30
AgsI TTSAA 1 cut(s) 118
AlwI GGATC 1 cut(s) 30
BccI CCATC 1 cut(s) 158
BciVI GTATCC 1 cut(s) 138
BfaI CTAG 1 cut(s) 57
BfuI GTATCC 1 cut(s) 138
BmsI GCATC 1 cut(s) 28
Bse1I ACTGG 1 cut(s) 76
BseMII CTCAG 1 cut(s) 39
BseNI ACTGG 1 cut(s) 76
Bsp143I GATC 2 cut(s) 22, 64
BspACI CCGC 1 cut(s) 32
BspCNI CTCAG 1 cut(s) 40
BspPI GGATC 1 cut(s) 30
BsrI ACTGG 1 cut(s) 76
BssMI GATC 2 cut(s) 22, 64
Bst4CI ACNGT 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 48
BstKTI GATC 2 cut(s) 25, 67
BstMBI GATC 2 cut(s) 22, 64
BstMWI GCNNNNNNNGC 1 cut(s) 38
BsuI GTATCC 1 cut(s) 138
BtsIMutI CAGTG 1 cut(s) 69
CviJI RGCY 1 cut(s) 113
CviKI_1 RGCY 1 cut(s) 113
DdeI CTNAG 1 cut(s) 48
DpnI GATC 2 cut(s) 24, 66
DpnII GATC 2 cut(s) 22, 64
FaiI YATR 2 cut(s) 90, 92
FspBI CTAG 1 cut(s) 57
HinfI GANTC 1 cut(s) 44
Hpy166II GTNNAC 1 cut(s) 54
Hpy188I TCNGA 2 cut(s) 22, 49
Hpy188III TCNNGA 2 cut(s) 8, 26
Hpy8I GTNNAC 1 cut(s) 54
Hpy99I CGWCG 1 cut(s) 22
HpyAV CCTTC 1 cut(s) 112
HpyCH4III ACNGT 1 cut(s) 87
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpyF3I CTNAG 1 cut(s) 48
Kzo9I GATC 2 cut(s) 22, 64
LpnPI CCDG 2 cut(s) 11, 57
LweI GCATC 1 cut(s) 28
MaeI CTAG 1 cut(s) 57
MaeIII GTNAC 1 cut(s) 77
MalI GATC 2 cut(s) 24, 66
MboI GATC 2 cut(s) 22, 64
MluCI AATT 1 cut(s) 175
MnlI CCTC 2 cut(s) 15, 88
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeII GATC 2 cut(s) 22, 64
PfeI GAWTC 1 cut(s) 44
Sau3AI GATC 2 cut(s) 22, 64
SetI ASST 1 cut(s) 99
SfaNI GCATC 1 cut(s) 28
SgeI CNNG 4 cut(s) 20, 38, 69, 84
SmlI CTYRAG 1 cut(s) 6
SmoI CTYRAG 1 cut(s) 6
Sse9I AATT 1 cut(s) 175
SsiI CCGC 1 cut(s) 32
SspMI CTAG 1 cut(s) 57
TaaI ACNGT 1 cut(s) 87
TasI AATT 1 cut(s) 175
TfiI GAWTC 1 cut(s) 44
TscAI CASTG 1 cut(s) 76
TspDTI ATGAA 1 cut(s) 148
TspGWI ACGGA 2 cut(s) 6, 96
TspRI CASTG 1 cut(s) 76
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.