Rroxscaffold_1G00025970

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0002870
Physical Location & Seq
Forward (+)
32613936 .. 32621699
7764 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00025970.1

Sequence Viewer

Length: 174 bp
ATGCCCGTATTTCGGATTAGCCGGGATCGCGTCCGTGCTCAAGGATTTTGGAGATCGGCGCTTCCGTTTTTGTCCGTAGCCGGGATCGCGTCCGGGCTCAAGGATTTTGGAGATCGGCGCTTCGTTTTTGTCCGTAGGTTATTACCTAACCTACCTTGTATGATATCGGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.5

Weight (kDa)

11.91

Isoelectric Point (pI)

63.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 30, 89
AclWI GGATC 2 cut(s) 33, 92
AfiI CCNNNNNNNGG 2 cut(s) 12, 81
Alw21I GWGCWC 1 cut(s) 40
AlwI GGATC 2 cut(s) 33, 92
AspLEI GCGC 2 cut(s) 61, 120
AsuC2I CCSGG 3 cut(s) 23, 82, 94
BanII GRGCYC 1 cut(s) 99
Bbv12I GWGCWC 1 cut(s) 40
BcnI CCSGG 3 cut(s) 23, 82, 94
BfoI RGCGCY 2 cut(s) 62, 121
Bme1390I CCNGG 3 cut(s) 23, 82, 94
BmrFI CCNGG 3 cut(s) 23, 82, 94
BpuEI CTTGAG 2 cut(s) 24, 83
BpuMI CCSGG 3 cut(s) 23, 82, 94
Bsc4I CCNNNNNNNGG 2 cut(s) 12, 81
BseLI CCNNNNNNNGG 2 cut(s) 12, 81
Bsh1236I CGCG 2 cut(s) 30, 89
BsiHKAI GWGCWC 1 cut(s) 40
BsiSI CCGG 3 cut(s) 22, 81, 93
BslI CCNNNNNNNGG 2 cut(s) 12, 81
Bsp1286I GDGCHC 2 cut(s) 40, 99
Bsp143I GATC 4 cut(s) 25, 53, 84, 112
BspFNI CGCG 2 cut(s) 30, 89
BspPI GGATC 2 cut(s) 33, 92
BssMI GATC 4 cut(s) 25, 53, 84, 112
BstDEI CTNAG 1 cut(s) 171
BstFNI CGCG 2 cut(s) 30, 89
BstH2I RGCGCY 2 cut(s) 62, 121
BstHHI GCGC 2 cut(s) 61, 120
BstKTI GATC 4 cut(s) 28, 56, 87, 115
BstMBI GATC 4 cut(s) 25, 53, 84, 112
BstMWI GCNNNNNNNGC 2 cut(s) 27, 86
BstSCI CCNGG 3 cut(s) 21, 80, 92
BstUI CGCG 2 cut(s) 30, 89
CfoI GCGC 2 cut(s) 61, 120
CseI GACGC 2 cut(s) 19, 78
CviJI RGCY 4 cut(s) 21, 80, 97, 170
CviKI_1 RGCY 4 cut(s) 21, 80, 97, 170
DdeI CTNAG 1 cut(s) 171
DpnI GATC 4 cut(s) 27, 55, 86, 114
DpnII GATC 4 cut(s) 25, 53, 84, 112
Eco24I GRGCYC 1 cut(s) 99
Eco32I GATATC 1 cut(s) 165
EcoRV GATATC 1 cut(s) 165
EcoT38I GRGCYC 1 cut(s) 99
FaiI YATR 1 cut(s) 161
FriOI GRGCYC 1 cut(s) 99
GlaI GCGC 2 cut(s) 60, 119
HaeII RGCGCY 2 cut(s) 62, 121
HapII CCGG 3 cut(s) 22, 81, 93
HgaI GACGC 2 cut(s) 19, 78
HhaI GCGC 2 cut(s) 61, 120
Hin6I GCGC 2 cut(s) 59, 118
HinP1I GCGC 2 cut(s) 59, 118
HpaII CCGG 3 cut(s) 22, 81, 93
Hpy188I TCNGA 1 cut(s) 15
HpyF10VI GCNNNNNNNGC 2 cut(s) 27, 86
HpyF3I CTNAG 1 cut(s) 171
HspAI GCGC 2 cut(s) 59, 118
Kzo9I GATC 4 cut(s) 25, 53, 84, 112
LpnPI CCDG 3 cut(s) 35, 94, 106
MalI GATC 4 cut(s) 27, 55, 86, 114
MboI GATC 4 cut(s) 25, 53, 84, 112
MhlI GDGCHC 2 cut(s) 40, 99
MspI CCGG 3 cut(s) 22, 81, 93
MspR9I CCNGG 3 cut(s) 23, 82, 94
MvnI CGCG 2 cut(s) 30, 89
MwoI GCNNNNNNNGC 2 cut(s) 27, 86
NciI CCSGG 3 cut(s) 23, 82, 94
NdeII GATC 4 cut(s) 25, 53, 84, 112
PcsI WCGNNNNNNNCGW 1 cut(s) 62
Sau3AI GATC 4 cut(s) 25, 53, 84, 112
ScrFI CCNGG 3 cut(s) 23, 82, 94
SduI GDGCHC 2 cut(s) 40, 99
SetI ASST 4 cut(s) 140, 148, 153, 157
SmlI CTYRAG 2 cut(s) 39, 98
SmoI CTYRAG 2 cut(s) 39, 98
StyD4I CCNGG 3 cut(s) 21, 80, 92
TspGWI ACGGA 4 cut(s) 23, 54, 64, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.