Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0022000.1

Orthogroup ID

OG0002870

Physical Location & Seq

Genomic Coordinates Forward (+)

621 .. 863

Gene Structure 243 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0022000.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 243 bp

atgaaaacagtgtacaaggcaattgatgagcttcttgggatggaggtggcatggaatcaggtgaggttcagtgaagtgcttcgctcaccagaggatttgcaacggctctattcagaggtccacctcctcagcaccctcagtcatgactccattattcggttctacacctcgtggatcgatgttgatcacaaaacttttaacttcattaccgaaatgttcacttcagggacactaagagagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0023052 GO:0035556 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0046777 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase

Protein Analysis

80

Amino Acids

9.49

Weight (kDa)

5.25

Isoelectric Point (pI)

45.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002870)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g07560
malus_domestica	MD07G1154000.v1.1
pyrus_communis	pycom14g14260 pycom16g16290
rosa_chinensis	RchiOBHm_Chr3g0469611 RchiOBHm_Chr5g0078081 RchiOBHm_Chr7g0208181
rosa_laevigata	RLG00000033831
rosa_multiflora	Rmu_co8062676.1_g000002 Rmu_sc0003108.1_g000027 Rmu_sc0006483.1_g000012 Rmu_sc0018944.1_g000001 Rmu_sc0022000.1_g000001 Rmu_sc0034052.1_g000001 Rmu_sc0041954.1_g000001
rosa_roxburghii	Rroxscaffold_1G00000580 Rroxscaffold_1G00006080 Rroxscaffold_1G00008040 Rroxscaffold_1G00008480 Rroxscaffold_1G00025750 Rroxscaffold_1G00025970 Rroxscaffold_1G00030650 Rroxscaffold_2G00092550 Rroxscaffold_3G00237550 Rroxscaffold_3G00245300 Rroxscaffold_4G00312850 Rroxscaffold_4G00312880 Rroxscaffold_4G00332520 Rroxscaffold_6G00411430
rosa_rugosa	Rorug06G0481400
rosa_samantha	Rh1CG136900 Rh2AG496900 Rh2CG482900 Rh3AG152300 Rh3CG167100 Rh5CG471900 Rh5CG472000 Rh7DG242000
rosa_wichuraiana	Rw7G010120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	182
AcuI	CTGAAG	1 cut(s)	207
AdeI	CACNNNGTG	1 cut(s)	171
AfaI	GTAC	1 cut(s)	14
AfiI	CCNNNNNNNGG	1 cut(s)	156
AluBI	AGCT	1 cut(s)	31
AluI	AGCT	1 cut(s)	31
AlwI	GGATC	1 cut(s)	182
Asp700I	GAANNNNTTC	1 cut(s)	78
AspS9I	GGNCC	1 cut(s)	118
AsuHPI	GGTGA	2 cut(s)	73, 78
AvaII	GGWCC	1 cut(s)	118
BauI	CACGAG	1 cut(s)	169
BbvCI	CCTCAGC	1 cut(s)	128
BccI	CCATC	1 cut(s)	34
BceAI	ACGGC	1 cut(s)	119
BclI	TGATCA	1 cut(s)	184
Bme18I	GGWCC	1 cut(s)	118
BmgT120I	GGNCC	1 cut(s)	118
Bpu10I	CCTNAGC	1 cut(s)	128
Bsa29I	ATCGAT	1 cut(s)	177
BsaBI	GATNNNNATC	1 cut(s)	183
Bsc4I	CCNNNNNNNGG	1 cut(s)	156
Bse8I	GATNNNNATC	1 cut(s)	183
BseCI	ATCGAT	1 cut(s)	177
BseGI	GGATG	1 cut(s)	45
BseJI	GATNNNNATC	1 cut(s)	183
BseLI	CCNNNNNNNGG	1 cut(s)	156
BseMII	CTCAG	2 cut(s)	142, 151
BseRI	GAGGAG	1 cut(s)	116
BshVI	ATCGAT	1 cut(s)	177
BslI	CCNNNNNNNGG	1 cut(s)	156
Bsp1407I	TGTACA	1 cut(s)	12
Bsp143I	GATC	2 cut(s)	174, 184
BspCNI	CTCAG	2 cut(s)	141, 150
BspDI	ATCGAT	1 cut(s)	177
BspHI	TCATGA	1 cut(s)	142
BspPI	GGATC	1 cut(s)	182
BsrGI	TGTACA	1 cut(s)	12
BssMI	GATC	2 cut(s)	174, 184
BssSI	CACGAG	1 cut(s)	169
Bst2BI	CACGAG	1 cut(s)	169
Bst4CI	ACNGT	1 cut(s)	10
BstAUI	TGTACA	1 cut(s)	12
BstDEI	CTNAG	3 cut(s)	128, 137, 233
BstF5I	GGATG	1 cut(s)	45
BstKTI	GATC	2 cut(s)	177, 187
BstMBI	GATC	2 cut(s)	174, 184
Bsu15I	ATCGAT	1 cut(s)	177
BsuTUI	ATCGAT	1 cut(s)	177
BtsCI	GGATG	1 cut(s)	45
BtsIMutI	CAGTG	2 cut(s)	15, 76
CciI	TCATGA	1 cut(s)	142
Cfr13I	GGNCC	1 cut(s)	118
ClaI	ATCGAT	1 cut(s)	177
Csp6I	GTAC	1 cut(s)	13
CviAII	CATG	2 cut(s)	51, 143
CviJI	RGCY	2 cut(s)	31, 106
CviKI_1	RGCY	2 cut(s)	31, 106
CviQI	GTAC	1 cut(s)	13
DdeI	CTNAG	3 cut(s)	128, 137, 233
DpnI	GATC	2 cut(s)	176, 186
DpnII	GATC	2 cut(s)	174, 184
DraIII	CACNNNGTG	1 cut(s)	171
Eco47I	GGWCC	1 cut(s)	118
Eco57I	CTGAAG	1 cut(s)	207
FaeI	CATG	2 cut(s)	54, 146
FaiI	YATR	2 cut(s)	52, 144
FatI	CATG	2 cut(s)	50, 142
FbaI	TGATCA	1 cut(s)	184
FokI	GGATG	1 cut(s)	52
Hin1II	CATG	2 cut(s)	54, 146
HinfI	GANTC	2 cut(s)	55, 146
HphI	GGTGA	2 cut(s)	73, 78
Hpy166II	GTNNAC	3 cut(s)	13, 121, 219
Hpy188I	TCNGA	1 cut(s)	115
Hpy188III	TCNNGA	1 cut(s)	143
Hpy8I	GTNNAC	3 cut(s)	13, 121, 219
HpyCH4III	ACNGT	1 cut(s)	10
HpyCH4V	TGCA	1 cut(s)	100
HpyF3I	CTNAG	3 cut(s)	128, 137, 233
Hsp92II	CATG	2 cut(s)	54, 146
Ksp22I	TGATCA	1 cut(s)	184
Kzo9I	GATC	2 cut(s)	174, 184
LpnPI	CCDG	3 cut(s)	44, 102, 210
MalI	GATC	2 cut(s)	176, 186
MboI	GATC	2 cut(s)	174, 184
MfeI	CAATTG	1 cut(s)	21
MluCI	AATT	1 cut(s)	21
MlyI	GAGTC	1 cut(s)	140
MnlI	CCTC	8 cut(s)	37, 57, 85, 109, 134, 137, 146, 178
MroXI	GAANNNNTTC	1 cut(s)	78
MseI	TTAA	1 cut(s)	198
MunI	CAATTG	1 cut(s)	21
NdeII	GATC	2 cut(s)	174, 184
NlaIII	CATG	2 cut(s)	54, 146
PagI	TCATGA	1 cut(s)	142
PdmI	GAANNNNTTC	1 cut(s)	78
PfeI	GAWTC	1 cut(s)	55
PleI	GAGTC	1 cut(s)	140
PpsI	GAGTC	1 cut(s)	140
PspPI	GGNCC	1 cut(s)	118
RsaI	GTAC	1 cut(s)	14
RsaNI	GTAC	1 cut(s)	13
SaqAI	TTAA	1 cut(s)	198
Sau3AI	GATC	2 cut(s)	174, 184
Sau96I	GGNCC	1 cut(s)	118
SchI	GAGTC	1 cut(s)	140
SetI	ASST	7 cut(s)	33, 48, 63, 68, 120, 126, 170
SgeI	CNNG	9 cut(s)	28, 47, 63, 71, 101, 155, 181, 183, 237
SinI	GGWCC	1 cut(s)	118
Sse9I	AATT	1 cut(s)	21
TaaI	ACNGT	1 cut(s)	10
TaqI	TCGA	1 cut(s)	177
TasI	AATT	1 cut(s)	21
TatI	WGTACW	1 cut(s)	12
TfiI	GAWTC	1 cut(s)	55
Tru1I	TTAA	1 cut(s)	198
Tru9I	TTAA	1 cut(s)	198
TscAI	CASTG	2 cut(s)	15, 76
TspDTI	ATGAA	2 cut(s)	17, 193
TspRI	CASTG	2 cut(s)	15, 76
VpaK11BI	GGWCC	1 cut(s)	118
XmnI	GAANNNNTTC	1 cut(s)	78

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.