Rmu_co8062676.1_g000002

Serine threonine-protein kinase WNK8-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8062676.1
Physical Location & Seq
Forward (+)
254 .. 570
317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8062676.1_g000002.1.cds

Sequence Viewer

Length: 317 bp
atggagaggaccgaatctgatacgagtgagtgtgactacgacgagtttgtggagcaagacccgaccgggaggtacttccggtacgacgacgttttggggaggggggcgttcaagactgtgtacaaggcttttgatgaggaagaagggattgaagtggcgtggagcaaagtcaagactgaggacgaggctgagcttcagagattgttttcggaggttaatctgctcaagtctttgaagcatgagaacatcatcaagctttttagctggtgggttgtggaggatgatgacgataatggtgactgtaaatccaagaagaa

Protein Analysis

105

Amino Acids

12.39

Weight (kDa)

4.4

Isoelectric Point (pI)

40.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 179
AfaI GTAC 3 cut(s) 74, 83, 122
AgsI TTSAA 3 cut(s) 112, 152, 235
AluBI AGCT 3 cut(s) 193, 256, 264
AluI AGCT 3 cut(s) 193, 256, 264
AspS9I GGNCC 1 cut(s) 9
AsuC2I CCSGG 1 cut(s) 67
AsuHPI GGTGA 1 cut(s) 308
AvaII GGWCC 1 cut(s) 9
BcnI CCSGG 1 cut(s) 67
BlpI GCTNAGC 1 cut(s) 189
Bme1390I CCNGG 1 cut(s) 67
Bme18I GGWCC 1 cut(s) 9
BmgT120I GGNCC 1 cut(s) 9
BmrFI CCNGG 1 cut(s) 67
Bpu1102I GCTNAGC 1 cut(s) 189
BpuEI CTTGAG 1 cut(s) 209
BpuMI CCSGG 1 cut(s) 67
BsaWI WCCGGW 1 cut(s) 78
BseGI GGATG 1 cut(s) 286
BseMII CTCAG 2 cut(s) 168, 180
Bsh1285I CGRYCG 1 cut(s) 66
BsiEI CGRYCG 1 cut(s) 66
BsiSI CCGG 2 cut(s) 66, 79
Bsp1407I TGTACA 1 cut(s) 120
Bsp1720I GCTNAGC 1 cut(s) 189
BspCNI CTCAG 2 cut(s) 169, 181
BsrGI TGTACA 1 cut(s) 120
Bst4CI ACNGT 2 cut(s) 118, 302
BstAUI TGTACA 1 cut(s) 120
BstDEI CTNAG 2 cut(s) 177, 189
BstF5I GGATG 1 cut(s) 286
BstMCI CGRYCG 1 cut(s) 66
BstSCI CCNGG 1 cut(s) 65
BtsCI GGATG 1 cut(s) 286
Cfr13I GGNCC 1 cut(s) 9
Csp6I GTAC 3 cut(s) 73, 82, 121
CviAII CATG 1 cut(s) 239
CviJI RGCY 5 cut(s) 128, 188, 193, 256, 264
CviKI_1 RGCY 5 cut(s) 128, 188, 193, 256, 264
CviQI GTAC 3 cut(s) 73, 82, 121
DdeI CTNAG 2 cut(s) 177, 189
Eco47I GGWCC 1 cut(s) 9
Eco57I CTGAAG 1 cut(s) 179
FaeI CATG 1 cut(s) 242
FaiI YATR 1 cut(s) 240
FatI CATG 1 cut(s) 238
FokI GGATG 1 cut(s) 293
HapII CCGG 2 cut(s) 66, 79
Hin1II CATG 1 cut(s) 242
HindIII AAGCTT 1 cut(s) 254
HinfI GANTC 1 cut(s) 14
HpaII CCGG 2 cut(s) 66, 79
HphI GGTGA 1 cut(s) 308
Hpy166II GTNNAC 1 cut(s) 121
Hpy188I TCNGA 3 cut(s) 19, 198, 211
Hpy188III TCNNGA 2 cut(s) 112, 172
Hpy8I GTNNAC 1 cut(s) 121
Hpy99I CGWCG 3 cut(s) 44, 89, 92
HpyAV CCTTC 1 cut(s) 137
HpyCH4III ACNGT 2 cut(s) 118, 302
HpyCH4IV ACGT 1 cut(s) 90
HpyF3I CTNAG 2 cut(s) 177, 189
HpySE526I ACGT 1 cut(s) 90
Hsp92II CATG 1 cut(s) 242
LmnI GCTCC 2 cut(s) 52, 162
LpnPI CCDG 3 cut(s) 79, 92, 250
MaeII ACGT 1 cut(s) 90
MaeIII GTNAC 2 cut(s) 32, 296
MboII GAAGA 1 cut(s) 152
MnlI CCTC 7 cut(s) 63, 93, 130, 172, 178, 205, 271
MseI TTAA 1 cut(s) 216
MspI CCGG 2 cut(s) 66, 79
MspR9I CCNGG 1 cut(s) 67
NciI CCSGG 1 cut(s) 67
NlaIII CATG 1 cut(s) 242
NmuCI GTSAC 2 cut(s) 32, 296
PfeI GAWTC 1 cut(s) 14
PspPI GGNCC 1 cut(s) 9
RsaI GTAC 3 cut(s) 74, 83, 122
RsaNI GTAC 3 cut(s) 73, 82, 121
SaqAI TTAA 1 cut(s) 216
Sau96I GGNCC 1 cut(s) 9
ScrFI CCNGG 1 cut(s) 67
SetI ASST 6 cut(s) 74, 93, 195, 216, 258, 266
SinI GGWCC 1 cut(s) 9
SmlI CTYRAG 1 cut(s) 224
SmoI CTYRAG 1 cut(s) 224
StyD4I CCNGG 1 cut(s) 65
TaaI ACNGT 2 cut(s) 118, 302
TaiI ACGT 1 cut(s) 93
TaqII GACCGA 1 cut(s) 26
TatI WGTACW 1 cut(s) 120
TfiI GAWTC 1 cut(s) 14
Tru1I TTAA 1 cut(s) 216
Tru9I TTAA 1 cut(s) 216
TseFI GTSAC 2 cut(s) 32, 296
Tsp45I GTSAC 2 cut(s) 32, 296
VpaK11BI GGWCC 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.