RchiOBHm_Chr4g0429731

Zinc finger protein CONSTANS-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
54466546 .. 54466728
183 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGGATGTTAGCGTCGTGCCAGATGGCAACATGCTGACGGAGCTGTTAGATCCCTACCCCAAGTCTATCGGCGATCAGTTAACGCATCCGACGGTTCAGATTTCATCGGCGGGACGGGAAGCTAGGGTGTTGAGGTATAGAGAGAAGAGAAAGAAACGAAAGTTCGAAAAGACGATTCGTTAA

Protein Analysis

60

Amino Acids

6.96

Weight (kDa)

9.99

Isoelectric Point (pI)

28.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 110
AclWI GGATC 1 cut(s) 44
AluBI AGCT 2 cut(s) 43, 122
AluI AGCT 2 cut(s) 43, 122
AlwI GGATC 1 cut(s) 44
AsuII TTCGAA 1 cut(s) 165
BccI CCATC 1 cut(s) 17
BfaI CTAG 1 cut(s) 123
BmsI GCATC 1 cut(s) 94
Bpu14I TTCGAA 1 cut(s) 165
BseGI GGATG 2 cut(s) 10, 85
BslFI GGGAC 1 cut(s) 126
BsmFI GGGAC 1 cut(s) 126
Bsp119I TTCGAA 1 cut(s) 165
Bsp143I GATC 2 cut(s) 49, 73
BspACI CCGC 1 cut(s) 110
BspPI GGATC 1 cut(s) 44
BspT104I TTCGAA 1 cut(s) 165
BssMI GATC 2 cut(s) 49, 73
Bst4CI ACNGT 1 cut(s) 94
Bst6I CTCTTC 1 cut(s) 140
BstBI TTCGAA 1 cut(s) 165
BstF5I GGATG 2 cut(s) 10, 85
BstKTI GATC 2 cut(s) 52, 76
BstMBI GATC 2 cut(s) 49, 73
BstMWI GCNNNNNNNGC 1 cut(s) 40
BstNSI RCATGY 1 cut(s) 34
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BtsCI GGATG 2 cut(s) 10, 85
CviAII CATG 1 cut(s) 31
CviJI RGCY 2 cut(s) 43, 122
CviKI_1 RGCY 2 cut(s) 43, 122
DpnI GATC 2 cut(s) 51, 75
DpnII GATC 2 cut(s) 49, 73
Eam1104I CTCTTC 1 cut(s) 140
EarI CTCTTC 1 cut(s) 140
FaeI CATG 1 cut(s) 34
FaiI YATR 2 cut(s) 32, 138
FaqI GGGAC 1 cut(s) 126
FatI CATG 1 cut(s) 30
FauI CCCGC 1 cut(s) 103
FokI GGATG 2 cut(s) 17, 72
FspBI CTAG 1 cut(s) 123
Hin1II CATG 1 cut(s) 34
HincII GTYRAC 1 cut(s) 81
HindII GTYRAC 1 cut(s) 81
HinfI GANTC 1 cut(s) 175
HpaI GTTAAC 1 cut(s) 81
Hpy166II GTNNAC 1 cut(s) 81
Hpy188I TCNGA 2 cut(s) 90, 99
Hpy8I GTNNAC 1 cut(s) 81
Hpy99I CGWCG 2 cut(s) 17, 94
HpyCH4III ACNGT 1 cut(s) 94
HpyF10VI GCNNNNNNNGC 1 cut(s) 40
Hsp92II CATG 1 cut(s) 34
KspAI GTTAAC 1 cut(s) 81
Kzo9I GATC 2 cut(s) 49, 73
LmnI GCTCC 1 cut(s) 40
LpnPI CCDG 1 cut(s) 33
LweI GCATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 123
MalI GATC 2 cut(s) 51, 75
MboI GATC 2 cut(s) 49, 73
MboII GAAGA 1 cut(s) 157
MflI RGATCY 1 cut(s) 49
MmeI TCCRAC 1 cut(s) 113
MnlI CCTC 1 cut(s) 126
MseI TTAA 2 cut(s) 80, 181
MwoI GCNNNNNNNGC 1 cut(s) 40
NdeII GATC 2 cut(s) 49, 73
NlaIII CATG 1 cut(s) 34
NspI RCATGY 1 cut(s) 34
NspV TTCGAA 1 cut(s) 165
PfeI GAWTC 1 cut(s) 175
PsuI RGATCY 1 cut(s) 49
SaqAI TTAA 2 cut(s) 80, 181
Sau3AI GATC 2 cut(s) 49, 73
SetI ASST 3 cut(s) 45, 124, 137
SfaNI GCATC 1 cut(s) 94
SfuI TTCGAA 1 cut(s) 165
SgeI CNNG 7 cut(s) 28, 32, 43, 73, 123, 128, 135
SsiI CCGC 1 cut(s) 110
SspMI CTAG 1 cut(s) 123
TaaI ACNGT 1 cut(s) 94
TaqI TCGA 1 cut(s) 165
TfiI GAWTC 1 cut(s) 175
Tru1I TTAA 2 cut(s) 80, 181
Tru9I TTAA 2 cut(s) 80, 181
TspDTI ATGAA 1 cut(s) 93
TspGWI ACGGA 1 cut(s) 53
XceI RCATGY 1 cut(s) 34
XspI CTAG 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.