RchiOBHm_Chr5g0068921

Zinc finger protein CONSTANS-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
74868342 .. 74869252
911 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34432

Sequence Viewer

Length: 183 bp
ATGGATGTTAGCGTCGTGCCAAATGGCAACATGCTGACAGAGTTGTTAGATCCCTACCCCAAGTCGATCGGCGATCAGTTAACGCATCCGGCGGCTCAGATTTCATCGGCGGAACGGGAAGCTAGGGTGTTGAGGTATAGAGAGAAGAGAAAGAATCGAAAGTTCGAAAAGACGATTCGTTAA

Protein Analysis

60

Amino Acids

6.95

Weight (kDa)

9.86

Isoelectric Point (pI)

24.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 92, 110
AclWI GGATC 1 cut(s) 44
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
AlwI GGATC 1 cut(s) 44
AsuII TTCGAA 1 cut(s) 165
BfaI CTAG 1 cut(s) 123
BisI GCNGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 94
BmsI GCATC 1 cut(s) 94
Bpu14I TTCGAA 1 cut(s) 165
BseGI GGATG 2 cut(s) 10, 85
BseMII CTCAG 1 cut(s) 110
Bsh1285I CGRYCG 1 cut(s) 69
BsiEI CGRYCG 1 cut(s) 69
BsiSI CCGG 1 cut(s) 89
Bsp119I TTCGAA 1 cut(s) 165
Bsp143I GATC 3 cut(s) 49, 66, 73
BspACI CCGC 2 cut(s) 92, 110
BspCNI CTCAG 1 cut(s) 109
BspPI GGATC 1 cut(s) 44
BspT104I TTCGAA 1 cut(s) 165
BssMI GATC 3 cut(s) 49, 66, 73
Bst6I CTCTTC 1 cut(s) 140
BstBI TTCGAA 1 cut(s) 165
BstDEI CTNAG 1 cut(s) 96
BstF5I GGATG 2 cut(s) 10, 85
BstKTI GATC 3 cut(s) 52, 69, 76
BstMBI GATC 3 cut(s) 49, 66, 73
BstMCI CGRYCG 1 cut(s) 69
BstNSI RCATGY 1 cut(s) 34
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BtsCI GGATG 2 cut(s) 10, 85
CviAII CATG 1 cut(s) 31
CviJI RGCY 2 cut(s) 95, 122
CviKI_1 RGCY 2 cut(s) 95, 122
DdeI CTNAG 1 cut(s) 96
DpnI GATC 3 cut(s) 51, 68, 75
DpnII GATC 3 cut(s) 49, 66, 73
Eam1104I CTCTTC 1 cut(s) 140
EarI CTCTTC 1 cut(s) 140
EciI GGCGGA 1 cut(s) 125
FaeI CATG 1 cut(s) 34
FaiI YATR 2 cut(s) 32, 138
FatI CATG 1 cut(s) 30
Fnu4HI GCNGC 1 cut(s) 93
FokI GGATG 2 cut(s) 17, 72
Fsp4HI GCNGC 1 cut(s) 93
FspBI CTAG 1 cut(s) 123
GluI GCNGC 1 cut(s) 93
HapII CCGG 1 cut(s) 89
Hin1II CATG 1 cut(s) 34
HincII GTYRAC 1 cut(s) 81
HindII GTYRAC 1 cut(s) 81
HinfI GANTC 2 cut(s) 154, 175
HpaI GTTAAC 1 cut(s) 81
HpaII CCGG 1 cut(s) 89
Hpy166II GTNNAC 1 cut(s) 81
Hpy188I TCNGA 1 cut(s) 99
Hpy8I GTNNAC 1 cut(s) 81
Hpy99I CGWCG 1 cut(s) 17
HpyF3I CTNAG 1 cut(s) 96
Hsp92II CATG 1 cut(s) 34
KspAI GTTAAC 1 cut(s) 81
Kzo9I GATC 3 cut(s) 49, 66, 73
LpnPI CCDG 1 cut(s) 102
LweI GCATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 123
MalI GATC 3 cut(s) 51, 68, 75
MboI GATC 3 cut(s) 49, 66, 73
MboII GAAGA 1 cut(s) 157
MflI RGATCY 1 cut(s) 49
MnlI CCTC 1 cut(s) 126
MseI TTAA 2 cut(s) 80, 181
MspI CCGG 1 cut(s) 89
NdeII GATC 3 cut(s) 49, 66, 73
NlaIII CATG 1 cut(s) 34
NspI RCATGY 1 cut(s) 34
NspV TTCGAA 1 cut(s) 165
PfeI GAWTC 2 cut(s) 154, 175
PkrI GCNGC 1 cut(s) 94
Ple19I CGATCG 1 cut(s) 69
PsuI RGATCY 1 cut(s) 49
PvuI CGATCG 1 cut(s) 69
SaqAI TTAA 2 cut(s) 80, 181
SatI GCNGC 1 cut(s) 93
Sau3AI GATC 3 cut(s) 49, 66, 73
SetI ASST 2 cut(s) 124, 137
SfaNI GCATC 1 cut(s) 94
SfuI TTCGAA 1 cut(s) 165
SgeI CNNG 6 cut(s) 28, 43, 73, 101, 128, 135
SsiI CCGC 2 cut(s) 92, 110
SspMI CTAG 1 cut(s) 123
TaqI TCGA 3 cut(s) 65, 157, 165
TauI GCSGC 1 cut(s) 95
TfiI GAWTC 2 cut(s) 154, 175
Tru1I TTAA 2 cut(s) 80, 181
Tru9I TTAA 2 cut(s) 80, 181
TspDTI ATGAA 1 cut(s) 93
XceI RCATGY 1 cut(s) 34
XspI CTAG 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.