Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0002857

Physical Location & Seq

Genomic Coordinates Reverse (-)

59557207 .. 59558372

Gene Structure 1166 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ59415

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

ATGTGGAAGCATCTAAGAAGTCTGAAGAAGATCATTACCGAATTGAACACAAATTGTGCTTTAAAAATCAAATCCATTATAGATTCGGAAAACTGCCAGTGCAGATCAGTCAACTTCAACAGAGTGTCACAAATCGATCAGAGCTCAGAAAATTATGATCTTTATATGGTTGGAAAGCTACGGATGTCTAGTTTCCAGAACTTTTTACAGCTCGTCGATATCTATTTTCTAGAAGACGTTATGACTATTTTAGTGCACTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

86

Amino Acids

10.16

Weight (kDa)

7.72

Isoelectric Point (pI)

47.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002857)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g02941
rosa_chinensis	RchiOBHm_Chr1g0327601 RchiOBHm_Chr1g0328211 RchiOBHm_Chr1g0328421 RchiOBHm_Chr1g0369921 RchiOBHm_Chr1g0371671 RchiOBHm_Chr1g0382031 RchiOBHm_Chr2g0130721 RchiOBHm_Chr2g0141321 RchiOBHm_Chr4g0401261 RchiOBHm_Chr4g0435071 RchiOBHm_Chr5g0030411 RchiOBHm_Chr5g0036821 RchiOBHm_Chr5g0070441 RchiOBHm_Chr6g0268181 RchiOBHm_Chr7g0222111
rosa_multiflora	Rmu_sc0003249.1_g000016 Rmu_sc0009671.1_g000003
rosa_roxburghii	Rroxscaffold_2G00095380 Rroxscaffold_2G00095630 Rroxscaffold_2G00110260 Rroxscaffold_2G00116450 Rroxscaffold_2G00117310 Rroxscaffold_3G00224120 Rroxscaffold_3G00275380 Rroxscaffold_4G00308610 Rroxscaffold_5G00338190 Rroxscaffold_5G00358130 Rroxscaffold_6G00389220 Rroxscaffold_7G00176840 Rroxscaffold_7G00198260
rosa_rugosa	Rorug03G0282500 Rorug05G0003200 Rorug06G0002200 Rorug07G0046500 Rorug07G0046600
rosa_samantha	Rh4AG337700 Rh4CG049400 Rh4DG340200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	44
AgsI	TTSAA	2 cut(s)	46, 118
AluBI	AGCT	3 cut(s)	144, 178, 211
AluI	AGCT	3 cut(s)	144, 178, 211
Alw21I	GWGCWC	2 cut(s)	146, 258
Alw44I	GTGCAC	1 cut(s)	254
ApaLI	GTGCAC	1 cut(s)	254
BaeGI	GKGCMC	1 cut(s)	258
BanII	GRGCYC	1 cut(s)	146
BbsI	GAAGAC	1 cut(s)	240
Bbv12I	GWGCWC	2 cut(s)	146, 258
BfaI	CTAG	2 cut(s)	189, 230
BmsI	GCATC	1 cut(s)	19
BpiI	GAAGAC	1 cut(s)	240
Bsa29I	ATCGAT	1 cut(s)	135
Bse1I	ACTGG	1 cut(s)	97
BseCI	ATCGAT	1 cut(s)	135
BseGI	GGATG	1 cut(s)	189
BseMII	CTCAG	1 cut(s)	159
BseNI	ACTGG	1 cut(s)	97
BseSI	GKGCMC	1 cut(s)	258
BsgI	GTGCAG	1 cut(s)	121
BshVI	ATCGAT	1 cut(s)	135
BsiHKAI	GWGCWC	2 cut(s)	146, 258
Bsp1286I	GDGCHC	2 cut(s)	146, 258
Bsp143I	GATC	4 cut(s)	30, 104, 136, 157
BspCNI	CTCAG	1 cut(s)	158
BspDI	ATCGAT	1 cut(s)	135
BsrI	ACTGG	1 cut(s)	97
BssMI	GATC	4 cut(s)	30, 104, 136, 157
BstDEI	CTNAG	2 cut(s)	14, 145
BstF5I	GGATG	1 cut(s)	189
BstKTI	GATC	4 cut(s)	33, 107, 139, 160
BstMBI	GATC	4 cut(s)	30, 104, 136, 157
BstSLI	GKGCMC	1 cut(s)	258
BstV2I	GAAGAC	1 cut(s)	240
Bsu15I	ATCGAT	1 cut(s)	135
BsuTUI	ATCGAT	1 cut(s)	135
BtsCI	GGATG	1 cut(s)	189
BtsIMutI	CAGTG	2 cut(s)	104, 256
ClaI	ATCGAT	1 cut(s)	135
CviJI	RGCY	3 cut(s)	144, 178, 211
CviKI_1	RGCY	3 cut(s)	144, 178, 211
DdeI	CTNAG	2 cut(s)	14, 145
DpnI	GATC	4 cut(s)	32, 106, 138, 159
DpnII	GATC	4 cut(s)	30, 104, 136, 157
DraI	TTTAAA	1 cut(s)	63
Ecl136II	GAGCTC	1 cut(s)	144
Eco24I	GRGCYC	1 cut(s)	146
Eco32I	GATATC	1 cut(s)	220
Eco53kI	GAGCTC	1 cut(s)	144
Eco57I	CTGAAG	1 cut(s)	44
EcoICRI	GAGCTC	1 cut(s)	144
EcoRV	GATATC	1 cut(s)	220
EcoT38I	GRGCYC	1 cut(s)	146
FaiI	YATR	5 cut(s)	80, 156, 165, 167, 242
FokI	GGATG	1 cut(s)	196
FriOI	GRGCYC	1 cut(s)	146
FspBI	CTAG	2 cut(s)	189, 230
FspEI	CC	8 cut(s)	52, 71, 88, 110, 152, 156, 166, 209
HincII	GTYRAC	1 cut(s)	112
HindII	GTYRAC	1 cut(s)	112
HinfI	GANTC	1 cut(s)	83
Hpy166II	GTNNAC	2 cut(s)	112, 256
Hpy188I	TCNGA	4 cut(s)	24, 88, 141, 148
Hpy188III	TCNNGA	2 cut(s)	196, 230
Hpy8I	GTNNAC	2 cut(s)	112, 256
Hpy99I	CGWCG	1 cut(s)	218
HpyCH4IV	ACGT	1 cut(s)	237
HpyCH4V	TGCA	2 cut(s)	102, 256
HpyF3I	CTNAG	2 cut(s)	14, 145
HpySE526I	ACGT	1 cut(s)	237
Kzo9I	GATC	4 cut(s)	30, 104, 136, 157
LpnPI	CCDG	2 cut(s)	110, 209
LweI	GCATC	1 cut(s)	19
MaeI	CTAG	2 cut(s)	189, 230
MaeII	ACGT	1 cut(s)	237
MaeIII	GTNAC	1 cut(s)	126
MalI	GATC	4 cut(s)	32, 106, 138, 159
MboI	GATC	4 cut(s)	30, 104, 136, 157
MboII	GAAGA	3 cut(s)	37, 40, 245
MhlI	GDGCHC	2 cut(s)	146, 258
MluCI	AATT	3 cut(s)	41, 52, 151
MmeI	TCCRAC	1 cut(s)	151
MseI	TTAA	1 cut(s)	62
NdeII	GATC	4 cut(s)	30, 104, 136, 157
NmuCI	GTSAC	1 cut(s)	126
PfeI	GAWTC	1 cut(s)	83
Psp124BI	GAGCTC	1 cut(s)	146
SacI	GAGCTC	1 cut(s)	146
SaqAI	TTAA	1 cut(s)	62
Sau3AI	GATC	4 cut(s)	30, 104, 136, 157
SduI	GDGCHC	2 cut(s)	146, 258
SetI	ASST	4 cut(s)	146, 180, 213, 240
SfaNI	GCATC	1 cut(s)	19
SgeI	CNNG	5 cut(s)	109, 201, 208, 224, 242
Sse9I	AATT	3 cut(s)	41, 52, 151
SspMI	CTAG	2 cut(s)	189, 230
SstI	GAGCTC	1 cut(s)	146
TaiI	ACGT	1 cut(s)	240
TaqI	TCGA	2 cut(s)	135, 216
TasI	AATT	3 cut(s)	41, 52, 151
TfiI	GAWTC	1 cut(s)	83
Tru1I	TTAA	1 cut(s)	62
Tru9I	TTAA	1 cut(s)	62
TscAI	CASTG	1 cut(s)	104
TseFI	GTSAC	1 cut(s)	126
Tsp45I	GTSAC	1 cut(s)	126
TspGWI	ACGGA	1 cut(s)	196
TspRI	CASTG	1 cut(s)	104
VneI	GTGCAC	1 cut(s)	254
XbaI	TCTAGA	1 cut(s)	229
XspI	CTAG	2 cut(s)	189, 230

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.