RchiOBHm_Chr2g0141321

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
58874635 .. 58875950
1316 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51162

Sequence Viewer

Length: 192 bp
ATGTCTAGTTTCCAGATATTTTTACGGCTTGTCAATATCATTTTTCTAGAAGAAGTTATAGCCGATTTAGTACAAGAAGGTCATGCTAAGCGTGAATCTGAGGTTGGACGGGAATTTATGCTTCGAGGCCCAAATCACACCAAGAAGCTGGAGGACGAGTTTCTGCTTCGTATTCCGACTTATGGTGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.32

Weight (kDa)

5.59

Isoelectric Point (pI)

52.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 113
AfaI GTAC 1 cut(s) 72
AfiI CCNNNNNNNGG 1 cut(s) 182
AjuI GAANNNNNNNTTGG 2 cut(s) 87, 119
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
AoxI GGCC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 113
AspS9I GGNCC 1 cut(s) 128
BceAI ACGGC 1 cut(s) 41
BfaI CTAG 2 cut(s) 6, 47
BlpI GCTNAGC 1 cut(s) 87
BmgT120I GGNCC 1 cut(s) 128
BpmI CTGGAG 1 cut(s) 170
Bpu1102I GCTNAGC 1 cut(s) 87
BsaXI ACNNNNNCTCC 2 cut(s) 143, 173
Bsc4I CCNNNNNNNGG 1 cut(s) 182
BseLI CCNNNNNNNGG 1 cut(s) 182
BseMII CTCAG 1 cut(s) 90
BshFI GGCC 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 182
BsnI GGCC 1 cut(s) 129
Bsp1720I GCTNAGC 1 cut(s) 87
BspANI GGCC 1 cut(s) 129
BspCNI CTCAG 1 cut(s) 91
BstDEI CTNAG 2 cut(s) 87, 99
BstXI CCANNNNNNTGG 1 cut(s) 148
BsuRI GGCC 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 128
Csp6I GTAC 1 cut(s) 71
CviAII CATG 1 cut(s) 83
CviJI RGCY 4 cut(s) 28, 62, 129, 148
CviKI_1 RGCY 4 cut(s) 28, 62, 129, 148
CviQI GTAC 1 cut(s) 71
DdeI CTNAG 2 cut(s) 87, 99
FaeI CATG 1 cut(s) 86
FaiI YATR 4 cut(s) 59, 84, 119, 183
FatI CATG 1 cut(s) 82
FspBI CTAG 2 cut(s) 6, 47
GsuI CTGGAG 1 cut(s) 170
HaeIII GGCC 1 cut(s) 129
Hin1II CATG 1 cut(s) 86
HinfI GANTC 1 cut(s) 95
Hpy188I TCNGA 2 cut(s) 100, 177
Hpy188III TCNNGA 2 cut(s) 13, 47
HpyAV CCTTC 1 cut(s) 71
HpyF3I CTNAG 2 cut(s) 87, 99
Hsp92II CATG 1 cut(s) 86
LpnPI CCDG 2 cut(s) 26, 134
MaeI CTAG 2 cut(s) 6, 47
MboII GAAGA 1 cut(s) 62
MluCI AATT 1 cut(s) 113
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 3 cut(s) 94, 119, 145
NlaIII CATG 1 cut(s) 86
PfeI GAWTC 1 cut(s) 95
PspPI GGNCC 1 cut(s) 128
RsaI GTAC 1 cut(s) 72
RsaNI GTAC 1 cut(s) 71
Sau96I GGNCC 1 cut(s) 128
SetI ASST 3 cut(s) 82, 105, 150
Sse9I AATT 1 cut(s) 113
SspMI CTAG 2 cut(s) 6, 47
TaqI TCGA 1 cut(s) 124
TasI AATT 1 cut(s) 113
TatI WGTACW 1 cut(s) 70
TfiI GAWTC 1 cut(s) 95
XapI RAATTY 1 cut(s) 113
XbaI TCTAGA 1 cut(s) 46
XspI CTAG 2 cut(s) 6, 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.