Rroxscaffold_2G00110260

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
34470466 .. 34477053
6588 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00110260.1

Sequence Viewer

Length: 240 bp
ATGTTTCTACTTCAAACAAGGCGCGGAAGATATGTGGAAGCATCTAGAAGTCTCAAGAAGATCATTACCGAATTGGACACAAATTGTGCTTTAAAAATCAAATCCATTACAGATTCGGAAAACTGCCACTGCAGATCAGTCAACTTCAACGGAGTGTCAAAAATCGGTCAGAGATCAGAAAATTATGATCTTTATATGGTTGGAAATCTACGGATGTCTAGTTTCCAGAAATTTTTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.16

Weight (kDa)

9.6

Isoelectric Point (pI)

54.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 24
AciI CCGC 1 cut(s) 24
AcsI RAATTY 1 cut(s) 230
AgsI TTSAA 2 cut(s) 14, 148
Alw26I GTCTC 1 cut(s) 56
ApoI RAATTY 1 cut(s) 230
AspLEI GCGC 1 cut(s) 24
BcoDI GTCTC 1 cut(s) 56
BfaI CTAG 2 cut(s) 45, 219
BfmI CTRYAG 1 cut(s) 130
BmsI GCATC 1 cut(s) 50
BpuEI CTTGAG 1 cut(s) 38
BseGI GGATG 1 cut(s) 219
Bsh1236I CGCG 1 cut(s) 24
BsmAI GTCTC 1 cut(s) 56
Bsp143I GATC 4 cut(s) 60, 134, 173, 187
BspACI CCGC 1 cut(s) 24
BspFNI CGCG 1 cut(s) 24
BspMAI CTGCAG 1 cut(s) 134
BssMI GATC 4 cut(s) 60, 134, 173, 187
BstF5I GGATG 1 cut(s) 219
BstFNI CGCG 1 cut(s) 24
BstHHI GCGC 1 cut(s) 24
BstKTI GATC 4 cut(s) 63, 137, 176, 190
BstMAI GTCTC 1 cut(s) 56
BstMBI GATC 4 cut(s) 60, 134, 173, 187
BstSFI CTRYAG 1 cut(s) 130
BstUI CGCG 1 cut(s) 24
BtsCI GGATG 1 cut(s) 219
BtsI GCAGTG 1 cut(s) 127
BtsIMutI CAGTG 1 cut(s) 127
CfoI GCGC 1 cut(s) 24
DpnI GATC 4 cut(s) 62, 136, 175, 189
DpnII GATC 4 cut(s) 60, 134, 173, 187
DraI TTTAAA 1 cut(s) 93
FaiI YATR 5 cut(s) 33, 186, 195, 197, 238
FokI GGATG 1 cut(s) 226
FspBI CTAG 2 cut(s) 45, 219
GlaI GCGC 1 cut(s) 23
HhaI GCGC 1 cut(s) 24
Hin6I GCGC 1 cut(s) 22
HinP1I GCGC 1 cut(s) 22
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
HinfI GANTC 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 142
Hpy188I TCNGA 3 cut(s) 118, 171, 178
Hpy188III TCNNGA 3 cut(s) 45, 55, 226
Hpy8I GTNNAC 1 cut(s) 142
HpyCH4V TGCA 1 cut(s) 132
HspAI GCGC 1 cut(s) 22
Kzo9I GATC 4 cut(s) 60, 134, 173, 187
LweI GCATC 1 cut(s) 50
MaeI CTAG 2 cut(s) 45, 219
MalI GATC 4 cut(s) 62, 136, 175, 189
MboI GATC 4 cut(s) 60, 134, 173, 187
MboII GAAGA 2 cut(s) 39, 70
MluCI AATT 4 cut(s) 71, 82, 181, 230
MmeI TCCRAC 1 cut(s) 181
MseI TTAA 1 cut(s) 92
MvnI CGCG 1 cut(s) 24
NdeII GATC 4 cut(s) 60, 134, 173, 187
PfeI GAWTC 1 cut(s) 113
PstI CTGCAG 1 cut(s) 134
SaqAI TTAA 1 cut(s) 92
Sau3AI GATC 4 cut(s) 60, 134, 173, 187
SfaNI GCATC 1 cut(s) 50
SfcI CTRYAG 1 cut(s) 130
SgeI CNNG 5 cut(s) 30, 35, 57, 67, 231
SmlI CTYRAG 1 cut(s) 53
SmoI CTYRAG 1 cut(s) 53
Sse9I AATT 4 cut(s) 71, 82, 181, 230
SsiI CCGC 1 cut(s) 24
SspMI CTAG 2 cut(s) 45, 219
TaqII GACCGA 1 cut(s) 155
TasI AATT 4 cut(s) 71, 82, 181, 230
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
TscAI CASTG 1 cut(s) 134
TspGWI ACGGA 2 cut(s) 165, 226
TspRI CASTG 1 cut(s) 134
XapI RAATTY 1 cut(s) 230
XbaI TCTAGA 1 cut(s) 44
XspI CTAG 2 cut(s) 45, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.