Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009671.1

Orthogroup ID

OG0002857

Physical Location & Seq

Genomic Coordinates Reverse (-)

7897 .. 10228

Gene Structure 2332 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009671.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 783 bp

atggctgatggaatatcttctagggtatcttggagtaagaagaagaaaagaaggaaaagagggattgaagcgcaaaatcagcaaatctgcctgtgcagatcagtcaatttcgacagatcactgagaccatctcacaatgatccagatgatgatctttatgttgatggaaagccttggatgtctagtttccaaatctttttacggctcatcaatatcatttttctagagaaagttatggccgatttagtacaagaatgtcaggctgcgcgtgaatacgaggttggacgggaatttatgtttcgaggcccaaatcacaccaagaagcccgaggacgagtttgtgcttcatattccgactcatgatggacaaatggcacgatgtgaatggtgtatgcttactcgtagaactgctcaaggcaatcttacccccttggattcagagatagaacgcacttgcaagtcgaataggaagcaaacgaagggaactagtttgccaattcacgacacaacggctggttctacttcctcacaaggggaggaggaggagaacacaccaccaaactcacctgcgcattcaattcacgaggacgaagaggaacccccaagactcgacatggcattgaaggatgcttttgttccgacagcttcggaatccccctcatgcatagcttacacaccacctggcaatcaagccttctccattcctgtgcagctccttaactcgttgcctaagtactctggcacaccatctgaggatcctaatgttcacattagggaatcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2

Protein Analysis

260

Amino Acids

29.4

Weight (kDa)

5.8

Isoelectric Point (pI)

63.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002857)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g02941
rosa_chinensis	RchiOBHm_Chr1g0327601 RchiOBHm_Chr1g0328211 RchiOBHm_Chr1g0328421 RchiOBHm_Chr1g0369921 RchiOBHm_Chr1g0371671 RchiOBHm_Chr1g0382031 RchiOBHm_Chr2g0130721 RchiOBHm_Chr2g0141321 RchiOBHm_Chr4g0401261 RchiOBHm_Chr4g0435071 RchiOBHm_Chr5g0030411 RchiOBHm_Chr5g0036821 RchiOBHm_Chr5g0070441 RchiOBHm_Chr6g0268181 RchiOBHm_Chr7g0222111
rosa_multiflora	Rmu_sc0003249.1_g000016 Rmu_sc0009671.1_g000003
rosa_roxburghii	Rroxscaffold_2G00095380 Rroxscaffold_2G00095630 Rroxscaffold_2G00110260 Rroxscaffold_2G00116450 Rroxscaffold_2G00117310 Rroxscaffold_3G00224120 Rroxscaffold_3G00275380 Rroxscaffold_4G00308610 Rroxscaffold_5G00338190 Rroxscaffold_5G00358130 Rroxscaffold_6G00389220 Rroxscaffold_7G00176840 Rroxscaffold_7G00198260
rosa_rugosa	Rorug03G0282500 Rorug05G0003200 Rorug06G0002200 Rorug07G0046500 Rorug07G0046600
rosa_samantha	Rh4AG337700 Rh4CG049400 Rh4DG340200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	574
Acc16I	TGCGCA	1 cut(s)	570
Acc36I	ACCTGC	1 cut(s)	574
AccII	CGCG	1 cut(s)	268
AclWI	GGATC	3 cut(s)	134, 749, 762
AcoI	YGGCCR	1 cut(s)	237
AcsI	RAATTY	1 cut(s)	290
AdeI	CACNNNGTG	1 cut(s)	380
AfaI	GTAC	2 cut(s)	249, 734
AfiI	CCNNNNNNNGG	1 cut(s)	531
AgsI	TTSAA	3 cut(s)	68, 576, 622
AhlI	ACTAGT	1 cut(s)	485
AjnI	CCWGG	1 cut(s)	679
AjuI	GAANNNNNNNTTGG	2 cut(s)	264, 296
AluBI	AGCT	3 cut(s)	644, 668, 712
AluI	AGCT	3 cut(s)	644, 668, 712
Alw26I	GTCTC	1 cut(s)	118
AlwI	GGATC	3 cut(s)	134, 749, 762
Ama87I	CYCGRG	1 cut(s)	326
AoxI	GGCC	2 cut(s)	237, 304
ApeKI	GCWGC	2 cut(s)	263, 709
ApoI	RAATTY	1 cut(s)	290
Asp700I	GAANNNNTTC	1 cut(s)	16
AspLEI	GCGC	3 cut(s)	73, 268, 571
AspS9I	GGNCC	1 cut(s)	305
AsuHPI	GGTGA	1 cut(s)	555
AvaI	CYCGRG	1 cut(s)	326
BamHI	GGATCC	1 cut(s)	754
BauI	CACGAG	1 cut(s)	581
BbvI	GCAGC	2 cut(s)	250, 721
BccI	CCATC	5 cut(s)	2, 136, 158, 356, 754
BceAI	ACGGC	2 cut(s)	218, 525
BciT130I	CCWGG	1 cut(s)	681
BcoDI	GTCTC	1 cut(s)	118
BcuI	ACTAGT	1 cut(s)	485
BfaI	CTAG	4 cut(s)	21, 183, 224, 486
BfuAI	ACCTGC	1 cut(s)	574
BisI	GCNGC	2 cut(s)	264, 710
BlsI	GCNGC	2 cut(s)	265, 711
BmcAI	AGTACT	1 cut(s)	734
Bme1390I	CCNGG	1 cut(s)	681
BmeT110I	CYCGRG	1 cut(s)	326
BmgT120I	GGNCC	1 cut(s)	305
BmiI	GGNNCC	2 cut(s)	597, 756
BmrFI	CCNGG	1 cut(s)	681
BmsI	GCATC	1 cut(s)	616
BplI	GAGNNNNNCTC	2 cut(s)	115, 147
BpuEI	CTTGAG	1 cut(s)	396
BsaBI	GATNNNNATC	1 cut(s)	150
BsaI	GGTCTC	1 cut(s)	118
BsaJI	CCNNGG	3 cut(s)	173, 327, 429
Bsc4I	CCNNNNNNNGG	1 cut(s)	531
Bse8I	GATNNNNATC	1 cut(s)	150
BseBI	CCWGG	1 cut(s)	681
BseDI	CCNNGG	3 cut(s)	173, 327, 429
BseGI	GGATG	2 cut(s)	183, 631
BseJI	GATNNNNATC	1 cut(s)	150
BseLI	CCNNNNNNNGG	1 cut(s)	531
BseMII	CTCAG	2 cut(s)	113, 741
BseRI	GAGGAG	3 cut(s)	551, 554, 557
BseXI	GCAGC	2 cut(s)	250, 721
BsgI	GTGCAG	2 cut(s)	115, 728
Bsh1236I	CGCG	1 cut(s)	268
BshFI	GGCC	2 cut(s)	239, 306
BsiHKCI	CYCGRG	1 cut(s)	326
BslI	CCNNNNNNNGG	1 cut(s)	531
BsmAI	GTCTC	1 cut(s)	118
BsmI	GAATGC	1 cut(s)	571
BsnI	GGCC	2 cut(s)	239, 306
Bso31I	GGTCTC	1 cut(s)	118
BsoBI	CYCGRG	1 cut(s)	326
Bsp143I	GATC	5 cut(s)	98, 116, 139, 151, 754
BspANI	GGCC	2 cut(s)	239, 306
BspCNI	CTCAG	2 cut(s)	114, 742
BspFNI	CGCG	1 cut(s)	268
BspHI	TCATGA	1 cut(s)	358
BspLI	GGNNCC	2 cut(s)	597, 756
BspMI	ACCTGC	1 cut(s)	574
BspPI	GGATC	3 cut(s)	134, 749, 762
BspTNI	GGTCTC	1 cut(s)	118
BssECI	CCNNGG	3 cut(s)	173, 327, 429
BssMI	GATC	5 cut(s)	98, 116, 139, 151, 754
BssSI	CACGAG	1 cut(s)	581
BssT1I	CCWWGG	2 cut(s)	173, 429
Bst2BI	CACGAG	1 cut(s)	581
Bst2UI	CCWGG	1 cut(s)	681
Bst6I	CTCTTC	1 cut(s)	585
BstDEI	CTNAG	4 cut(s)	122, 729, 750, 780
BstF5I	GGATG	2 cut(s)	183, 631
BstFNI	CGCG	1 cut(s)	268
BstHHI	GCGC	3 cut(s)	73, 268, 571
BstKTI	GATC	5 cut(s)	101, 119, 142, 154, 757
BstMAI	GTCTC	1 cut(s)	118
BstMBI	GATC	5 cut(s)	98, 116, 139, 151, 754
BstMWI	GCNNNNNNNGC	1 cut(s)	79
BstNI	CCWGG	1 cut(s)	681
BstSCI	CCNGG	1 cut(s)	679
BstUI	CGCG	1 cut(s)	268
BstV1I	GCAGC	2 cut(s)	250, 721
BstX2I	RGATCY	1 cut(s)	754
BstYI	RGATCY	1 cut(s)	754
BsuRI	GGCC	2 cut(s)	239, 306
BtsCI	GGATG	2 cut(s)	183, 631
BtsIMutI	CAGTG	1 cut(s)	119
BveI	ACCTGC	1 cut(s)	574
CciI	TCATGA	1 cut(s)	358
CfoI	GCGC	3 cut(s)	73, 268, 571
Cfr13I	GGNCC	1 cut(s)	305
Csp6I	GTAC	2 cut(s)	248, 733
CviAII	CATG	3 cut(s)	359, 613, 660
CviQI	GTAC	2 cut(s)	248, 733
DdeI	CTNAG	4 cut(s)	122, 729, 750, 780
DpnI	GATC	5 cut(s)	100, 118, 141, 153, 756
DpnII	GATC	5 cut(s)	98, 116, 139, 151, 754
DraIII	CACNNNGTG	1 cut(s)	380
EaeI	YGGCCR	1 cut(s)	237
Eam1104I	CTCTTC	1 cut(s)	585
EarI	CTCTTC	1 cut(s)	585
Eco130I	CCWWGG	2 cut(s)	173, 429
Eco31I	GGTCTC	1 cut(s)	118
Eco88I	CYCGRG	1 cut(s)	326
EcoRII	CCWGG	1 cut(s)	679
EcoT14I	CCWWGG	2 cut(s)	173, 429
EcoT22I	ATGCAT	1 cut(s)	665
ErhI	CCWWGG	2 cut(s)	173, 429
FaeI	CATG	3 cut(s)	362, 616, 663
FaiI	YATR	9 cut(s)	159, 236, 296, 348, 360, 392, 614, 661, 665
FalI	AAGNNNNNCTT	2 cut(s)	405, 437
FatI	CATG	3 cut(s)	358, 612, 659
Fnu4HI	GCNGC	2 cut(s)	264, 710
FokI	GGATG	2 cut(s)	190, 638
Fsp4HI	GCNGC	2 cut(s)	264, 710
FspBI	CTAG	4 cut(s)	21, 183, 224, 486
FspI	TGCGCA	1 cut(s)	570
GlaI	GCGC	3 cut(s)	72, 267, 570
GluI	GCNGC	2 cut(s)	264, 710
HaeIII	GGCC	2 cut(s)	239, 306
HhaI	GCGC	3 cut(s)	73, 268, 571
Hin1II	CATG	3 cut(s)	362, 616, 663
Hin6I	GCGC	3 cut(s)	71, 266, 569
HinP1I	GCGC	3 cut(s)	71, 266, 569
HinfI	GANTC	5 cut(s)	355, 434, 606, 650, 776
HphI	GGTGA	1 cut(s)	555
Hpy166II	GTNNAC	1 cut(s)	766
Hpy188I	TCNGA	5 cut(s)	354, 439, 639, 649, 751
Hpy188III	TCNNGA	5 cut(s)	143, 224, 359, 500, 581
Hpy8I	GTNNAC	1 cut(s)	766
HpyAV	CCTTC	4 cut(s)	45, 472, 616, 703
HpyCH4V	TGCA	4 cut(s)	96, 456, 663, 709
HpyF10VI	GCNNNNNNNGC	1 cut(s)	79
HpyF3I	CTNAG	4 cut(s)	122, 729, 750, 780
Hsp92II	CATG	3 cut(s)	362, 616, 663
HspAI	GCGC	3 cut(s)	71, 266, 569
Kzo9I	GATC	5 cut(s)	98, 116, 139, 151, 754
LmnI	GCTCC	1 cut(s)	717
LpnPI	CCDG	9 cut(s)	104, 156, 245, 498, 579, 666, 693, 717, 723
Lsp1109I	GCAGC	2 cut(s)	250, 721
LweI	GCATC	1 cut(s)	616
MaeI	CTAG	4 cut(s)	21, 183, 224, 486
MalI	GATC	5 cut(s)	100, 118, 141, 153, 756
MboI	GATC	5 cut(s)	98, 116, 139, 151, 754
MboII	GAAGA	4 cut(s)	9, 52, 55, 602
MflI	RGATCY	1 cut(s)	754
MluCI	AATT	4 cut(s)	106, 290, 495, 576
MlyI	GAGTC	2 cut(s)	349, 600
MmeI	TCCRAC	3 cut(s)	262, 377, 662
Mph1103I	ATGCAT	1 cut(s)	665
MroXI	GAANNNNTTC	1 cut(s)	16
MseI	TTAA	1 cut(s)	717
MslI	CAYNNNNRTG	1 cut(s)	704
MspR9I	CCNGG	1 cut(s)	681
Mva1269I	GAATGC	1 cut(s)	571
MvaI	CCWGG	1 cut(s)	681
MvnI	CGCG	1 cut(s)	268
MwoI	GCNNNNNNNGC	1 cut(s)	79
NdeII	GATC	5 cut(s)	98, 116, 139, 151, 754
NlaIII	CATG	3 cut(s)	362, 616, 663
NlaIV	GGNNCC	2 cut(s)	597, 756
NsbI	TGCGCA	1 cut(s)	570
NsiI	ATGCAT	1 cut(s)	665
PagI	TCATGA	1 cut(s)	358
PaqCI	CACCTGC	1 cut(s)	574
PctI	GAATGC	1 cut(s)	571
PdmI	GAANNNNTTC	1 cut(s)	16
PfeI	GAWTC	3 cut(s)	434, 650, 776
PkrI	GCNGC	2 cut(s)	265, 711
PleI	GAGTC	2 cut(s)	349, 600
PpsI	GAGTC	2 cut(s)	349, 600
Psp6I	CCWGG	1 cut(s)	679
PspGI	CCWGG	1 cut(s)	679
PspN4I	GGNNCC	2 cut(s)	597, 756
PspPI	GGNCC	1 cut(s)	305
PsuI	RGATCY	1 cut(s)	754
RsaI	GTAC	2 cut(s)	249, 734
RsaNI	GTAC	2 cut(s)	248, 733
RseI	CAYNNNNRTG	1 cut(s)	704
SaqAI	TTAA	1 cut(s)	717
SatI	GCNGC	2 cut(s)	264, 710
Sau3AI	GATC	5 cut(s)	98, 116, 139, 151, 754
Sau96I	GGNCC	1 cut(s)	305
ScaI	AGTACT	1 cut(s)	734
SchI	GAGTC	2 cut(s)	349, 600
ScrFI	CCNGG	1 cut(s)	681
SetI	ASST	6 cut(s)	282, 568, 646, 670, 682, 714
SfaNI	GCATC	1 cut(s)	616
SmiMI	CAYNNNNRTG	1 cut(s)	704
SmlI	CTYRAG	1 cut(s)	411
SmoI	CTYRAG	1 cut(s)	411
SpeI	ACTAGT	1 cut(s)	485
Sse9I	AATT	4 cut(s)	106, 290, 495, 576
SspMI	CTAG	4 cut(s)	21, 183, 224, 486
StyD4I	CCNGG	1 cut(s)	679
StyI	CCWWGG	2 cut(s)	173, 429
TaqI	TCGA	4 cut(s)	111, 301, 461, 609
TasI	AATT	4 cut(s)	106, 290, 495, 576
TatI	WGTACW	2 cut(s)	247, 732
TfiI	GAWTC	3 cut(s)	434, 650, 776
Tru1I	TTAA	1 cut(s)	717
Tru9I	TTAA	1 cut(s)	717
TscAI	CASTG	1 cut(s)	126
TseI	GCWGC	2 cut(s)	263, 709
TspDTI	ATGAA	1 cut(s)	335
TspRI	CASTG	1 cut(s)	126
XapI	RAATTY	1 cut(s)	290
XbaI	TCTAGA	1 cut(s)	223
XmnI	GAANNNNTTC	1 cut(s)	16
XspI	CTAG	4 cut(s)	21, 183, 224, 486
ZrmI	AGTACT	1 cut(s)	734
Zsp2I	ATGCAT	1 cut(s)	665

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.