Rroxscaffold_4G00308610

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
30146503 .. 30153076
6574 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00308610.1

Sequence Viewer

Length: 315 bp
ATGAAACTGAGAGCAGCTCAGAATGAACTAGAGGGTGATCTTTATATTCATGGAAATCCTTGGATGTCTAGTTTCCGAATCTTTTTACGGTTTGTTAATATCATTTTTCTACAAGAAGTTATGGCCGATTTAGTACAGCAAGGTCGGGCAGTCCGGGAATCTGACACTTTGACGGAAATCCATGATTTGAGGCCCGAATTCCTTTTAGAAGCCCACCGACGAGTATTAACTGAATATCTCTGGTTATTAGAGATATATGACATATTTTTATGGGTGATATTAGAAATCTTAGAGGAGAAGCTACTTGAATCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

12.5

Weight (kDa)

4.76

Isoelectric Point (pI)

67.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 123
AcsI RAATTY 1 cut(s) 197
AfaI GTAC 1 cut(s) 135
AgsI TTSAA 1 cut(s) 308
AluBI AGCT 2 cut(s) 17, 301
AluI AGCT 2 cut(s) 17, 301
AoxI GGCC 2 cut(s) 123, 191
ApeKI GCWGC 1 cut(s) 14
ApoI RAATTY 1 cut(s) 197
AspS9I GGNCC 1 cut(s) 192
AsuC2I CCSGG 1 cut(s) 155
AsuHPI GGTGA 2 cut(s) 47, 286
BbvI GCAGC 1 cut(s) 26
BcnI CCSGG 1 cut(s) 155
BfaI CTAG 2 cut(s) 29, 69
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
Bme1390I CCNGG 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 192
BmrFI CCNGG 1 cut(s) 155
BplI GAGNNNNNCTC 1 cut(s) 33
BpuMI CCSGG 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 59
BseDI CCNNGG 1 cut(s) 59
BseGI GGATG 1 cut(s) 69
BseMII CTCAG 1 cut(s) 32
BseRI GAGGAG 1 cut(s) 308
BseXI GCAGC 1 cut(s) 26
BshFI GGCC 2 cut(s) 125, 193
BsiSI CCGG 1 cut(s) 154
BsnI GGCC 2 cut(s) 125, 193
Bsp143I GATC 1 cut(s) 37
BspANI GGCC 2 cut(s) 125, 193
BspCNI CTCAG 1 cut(s) 31
BssECI CCNNGG 1 cut(s) 59
BssMI GATC 1 cut(s) 37
BssT1I CCWWGG 1 cut(s) 59
Bst4CI ACNGT 1 cut(s) 90
BstDEI CTNAG 3 cut(s) 8, 18, 289
BstF5I GGATG 1 cut(s) 69
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstSCI CCNGG 1 cut(s) 153
BstV1I GCAGC 1 cut(s) 26
BsuRI GGCC 2 cut(s) 125, 193
BtsCI GGATG 1 cut(s) 69
Cfr13I GGNCC 1 cut(s) 192
Csp6I GTAC 1 cut(s) 134
CviAII CATG 2 cut(s) 50, 182
CviJI RGCY 5 cut(s) 17, 125, 193, 212, 301
CviKI_1 RGCY 5 cut(s) 17, 125, 193, 212, 301
CviQI GTAC 1 cut(s) 134
DdeI CTNAG 3 cut(s) 8, 18, 289
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
EaeI YGGCCR 1 cut(s) 123
Eco130I CCWWGG 1 cut(s) 59
EcoRI GAATTC 1 cut(s) 197
EcoT14I CCWWGG 1 cut(s) 59
ErhI CCWWGG 1 cut(s) 59
FaeI CATG 2 cut(s) 53, 185
FaiI YATR 8 cut(s) 45, 51, 122, 183, 256, 258, 263, 271
FatI CATG 2 cut(s) 49, 181
Fnu4HI GCNGC 1 cut(s) 15
FokI GGATG 1 cut(s) 76
Fsp4HI GCNGC 1 cut(s) 15
FspBI CTAG 2 cut(s) 29, 69
GluI GCNGC 1 cut(s) 15
HaeIII GGCC 2 cut(s) 125, 193
HapII CCGG 1 cut(s) 154
Hin1II CATG 2 cut(s) 53, 185
HinfI GANTC 3 cut(s) 78, 158, 308
HpaII CCGG 1 cut(s) 154
HphI GGTGA 2 cut(s) 47, 286
Hpy188I TCNGA 3 cut(s) 21, 77, 163
Hpy99I CGWCG 1 cut(s) 222
HpyCH4III ACNGT 1 cut(s) 90
HpyF3I CTNAG 3 cut(s) 8, 18, 289
Hsp92II CATG 2 cut(s) 53, 185
Kzo9I GATC 1 cut(s) 37
LpnPI CCDG 2 cut(s) 167, 226
Lsp1109I GCAGC 1 cut(s) 26
MaeI CTAG 2 cut(s) 29, 69
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MluCI AATT 1 cut(s) 197
MnlI CCTC 3 cut(s) 25, 183, 286
MseI TTAA 2 cut(s) 96, 227
MspI CCGG 1 cut(s) 154
MspR9I CCNGG 1 cut(s) 155
NciI CCSGG 1 cut(s) 155
NdeII GATC 1 cut(s) 37
NlaIII CATG 2 cut(s) 53, 185
PfeI GAWTC 3 cut(s) 78, 158, 308
PfoI TCCNGGA 1 cut(s) 153
PkrI GCNGC 1 cut(s) 16
PspPI GGNCC 1 cut(s) 192
RsaI GTAC 1 cut(s) 135
RsaNI GTAC 1 cut(s) 134
SaqAI TTAA 2 cut(s) 96, 227
SatI GCNGC 1 cut(s) 15
Sau3AI GATC 1 cut(s) 37
Sau96I GGNCC 1 cut(s) 192
ScrFI CCNGG 1 cut(s) 155
SetI ASST 3 cut(s) 19, 145, 303
Sse9I AATT 1 cut(s) 197
SspMI CTAG 2 cut(s) 29, 69
StyD4I CCNGG 1 cut(s) 153
StyI CCWWGG 1 cut(s) 59
TaaI ACNGT 1 cut(s) 90
TasI AATT 1 cut(s) 197
TatI WGTACW 1 cut(s) 133
TfiI GAWTC 3 cut(s) 78, 158, 308
Tru1I TTAA 2 cut(s) 96, 227
Tru9I TTAA 2 cut(s) 96, 227
TseI GCWGC 1 cut(s) 14
TspDTI ATGAA 3 cut(s) 17, 38, 39
TspGWI ACGGA 1 cut(s) 188
XapI RAATTY 1 cut(s) 197
XspI CTAG 2 cut(s) 29, 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.