RchiOBHm_Chr2g0130721

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
46821468 .. 46821783
316 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50215

Sequence Viewer

Length: 237 bp
ATGAAGATCATTACCGAATTGAACACAAATTGTGCTTTAAAAATCAAATCCATTACAGATTCGGAAAACTGCCACTGCAGATCAGTCAACTTCAACGGAGTGTCAAAAATCGTTCAGAGCTCAGAAAATTATGATCTTTATATGGATGGAAAGCTACGGATGTCTAGTTTCCAGAACTTTTTACAGCTCGTCGATATCTATTTTCTAGAAGAAGTTATGACCGTTTTAGTACACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

9.01

Weight (kDa)

5.51

Isoelectric Point (pI)

44.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 231
AgsI TTSAA 2 cut(s) 22, 94
AluBI AGCT 3 cut(s) 120, 154, 187
AluI AGCT 3 cut(s) 120, 154, 187
Alw21I GWGCWC 1 cut(s) 122
BanII GRGCYC 1 cut(s) 122
Bbv12I GWGCWC 1 cut(s) 122
BccI CCATC 1 cut(s) 140
BfaI CTAG 2 cut(s) 165, 206
BfmI CTRYAG 1 cut(s) 76
BseGI GGATG 2 cut(s) 151, 165
BseMII CTCAG 1 cut(s) 135
BsiHKAI GWGCWC 1 cut(s) 122
Bsp1286I GDGCHC 1 cut(s) 122
Bsp143I GATC 3 cut(s) 6, 80, 133
BspCNI CTCAG 1 cut(s) 134
BspMAI CTGCAG 1 cut(s) 80
BssMI GATC 3 cut(s) 6, 80, 133
Bst4CI ACNGT 1 cut(s) 223
BstDEI CTNAG 1 cut(s) 121
BstF5I GGATG 2 cut(s) 151, 165
BstKTI GATC 3 cut(s) 9, 83, 136
BstMBI GATC 3 cut(s) 6, 80, 133
BstSFI CTRYAG 1 cut(s) 76
BtsCI GGATG 2 cut(s) 151, 165
BtsI GCAGTG 1 cut(s) 73
BtsIMutI CAGTG 2 cut(s) 73, 232
Csp6I GTAC 1 cut(s) 230
CviJI RGCY 3 cut(s) 120, 154, 187
CviKI_1 RGCY 3 cut(s) 120, 154, 187
CviQI GTAC 1 cut(s) 230
DdeI CTNAG 1 cut(s) 121
DpnI GATC 3 cut(s) 8, 82, 135
DpnII GATC 3 cut(s) 6, 80, 133
DraI TTTAAA 1 cut(s) 39
Ecl136II GAGCTC 1 cut(s) 120
Eco24I GRGCYC 1 cut(s) 122
Eco32I GATATC 1 cut(s) 196
Eco53kI GAGCTC 1 cut(s) 120
EcoICRI GAGCTC 1 cut(s) 120
EcoRV GATATC 1 cut(s) 196
EcoT38I GRGCYC 1 cut(s) 122
FaiI YATR 4 cut(s) 132, 141, 143, 218
FokI GGATG 2 cut(s) 158, 172
FriOI GRGCYC 1 cut(s) 122
FspBI CTAG 2 cut(s) 165, 206
FspEI CC 9 cut(s) 28, 47, 64, 81, 86, 128, 132, 142, 185
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HinfI GANTC 1 cut(s) 59
Hpy166II GTNNAC 2 cut(s) 88, 232
Hpy188I TCNGA 3 cut(s) 64, 117, 124
Hpy188III TCNNGA 2 cut(s) 172, 206
Hpy8I GTNNAC 2 cut(s) 88, 232
Hpy99I CGWCG 1 cut(s) 194
HpyCH4III ACNGT 1 cut(s) 223
HpyCH4V TGCA 1 cut(s) 78
HpyF3I CTNAG 1 cut(s) 121
Kzo9I GATC 3 cut(s) 6, 80, 133
LpnPI CCDG 1 cut(s) 185
MaeI CTAG 2 cut(s) 165, 206
MalI GATC 3 cut(s) 8, 82, 135
MboI GATC 3 cut(s) 6, 80, 133
MboII GAAGA 2 cut(s) 16, 221
MhlI GDGCHC 1 cut(s) 122
MluCI AATT 3 cut(s) 17, 28, 127
MseI TTAA 1 cut(s) 38
NdeII GATC 3 cut(s) 6, 80, 133
PfeI GAWTC 1 cut(s) 59
Psp124BI GAGCTC 1 cut(s) 122
PstI CTGCAG 1 cut(s) 80
RsaI GTAC 1 cut(s) 231
RsaNI GTAC 1 cut(s) 230
SacI GAGCTC 1 cut(s) 122
SaqAI TTAA 1 cut(s) 38
Sau3AI GATC 3 cut(s) 6, 80, 133
SduI GDGCHC 1 cut(s) 122
SetI ASST 3 cut(s) 122, 156, 189
SfcI CTRYAG 1 cut(s) 76
SgeI CNNG 4 cut(s) 177, 184, 200, 218
Sse9I AATT 3 cut(s) 17, 28, 127
SspMI CTAG 2 cut(s) 165, 206
SstI GAGCTC 1 cut(s) 122
TaaI ACNGT 1 cut(s) 223
TaqI TCGA 1 cut(s) 192
TasI AATT 3 cut(s) 17, 28, 127
TatI WGTACW 1 cut(s) 229
TfiI GAWTC 1 cut(s) 59
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
TscAI CASTG 1 cut(s) 80
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 111, 172
TspRI CASTG 1 cut(s) 80
XbaI TCTAGA 1 cut(s) 205
XspI CTAG 2 cut(s) 165, 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.