RchiOBHm_Chr6g0268181

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0002857
Physical Location & Seq
Reverse (-)
25014466 .. 25018433
3968 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24054

Sequence Viewer

Length: 216 bp
ATGTGGAGGCATGTGATGGCAAGGGAAACCGAATTGGACACAAGTTGTTCTATAAAAATCAAATCCATTACAGATTCGGAAAATTGCCAGTGCAGATCAGTCAACTTCAACGGAGTGTCAAAAATCGCTCAGAGAATTATGATCTTTATATGGTTGGAAAGCCACGGATGTCTAGTTTCCAGAACTTTTTACAGCTCGTCGATATCTATTTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.19

Weight (kDa)

8.48

Isoelectric Point (pI)

39.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 109
AluBI AGCT 1 cut(s) 195
AluI AGCT 1 cut(s) 195
BccI CCATC 1 cut(s) 10
BfaI CTAG 2 cut(s) 173, 214
BsaJI CCNNGG 1 cut(s) 163
Bse1I ACTGG 1 cut(s) 88
BseDI CCNNGG 1 cut(s) 163
BseGI GGATG 1 cut(s) 173
BseMII CTCAG 1 cut(s) 143
BseNI ACTGG 1 cut(s) 88
BsgI GTGCAG 1 cut(s) 112
Bsp143I GATC 2 cut(s) 95, 141
BspCNI CTCAG 1 cut(s) 142
BsrI ACTGG 1 cut(s) 88
BssECI CCNNGG 1 cut(s) 163
BssMI GATC 2 cut(s) 95, 141
BstDEI CTNAG 1 cut(s) 129
BstDSI CCRYGG 1 cut(s) 163
BstF5I GGATG 1 cut(s) 173
BstKTI GATC 2 cut(s) 98, 144
BstMBI GATC 2 cut(s) 95, 141
BstNSI RCATGY 1 cut(s) 14
BtgI CCRYGG 1 cut(s) 163
BtsCI GGATG 1 cut(s) 173
BtsIMutI CAGTG 1 cut(s) 95
CviAII CATG 1 cut(s) 11
CviJI RGCY 2 cut(s) 162, 195
CviKI_1 RGCY 2 cut(s) 162, 195
DdeI CTNAG 1 cut(s) 129
DpnI GATC 2 cut(s) 97, 143
DpnII GATC 2 cut(s) 95, 141
Eco32I GATATC 1 cut(s) 204
EcoRV GATATC 1 cut(s) 204
FaeI CATG 1 cut(s) 14
FaiI YATR 5 cut(s) 12, 53, 140, 149, 151
FatI CATG 1 cut(s) 10
FokI GGATG 1 cut(s) 180
FspBI CTAG 2 cut(s) 173, 214
Hin1II CATG 1 cut(s) 14
HincII GTYRAC 1 cut(s) 103
HindII GTYRAC 1 cut(s) 103
HinfI GANTC 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 2 cut(s) 79, 132
Hpy188III TCNNGA 1 cut(s) 180
Hpy8I GTNNAC 1 cut(s) 103
Hpy99I CGWCG 1 cut(s) 202
HpyCH4V TGCA 1 cut(s) 93
HpyF3I CTNAG 1 cut(s) 129
Hsp92II CATG 1 cut(s) 14
Kzo9I GATC 2 cut(s) 95, 141
LpnPI CCDG 2 cut(s) 101, 193
MaeI CTAG 2 cut(s) 173, 214
MalI GATC 2 cut(s) 97, 143
MboI GATC 2 cut(s) 95, 141
MluCI AATT 3 cut(s) 32, 82, 135
MmeI TCCRAC 1 cut(s) 135
NdeII GATC 2 cut(s) 95, 141
NlaIII CATG 1 cut(s) 14
NspI RCATGY 1 cut(s) 14
PfeI GAWTC 1 cut(s) 74
Sau3AI GATC 2 cut(s) 95, 141
SetI ASST 1 cut(s) 197
SgeI CNNG 8 cut(s) 23, 33, 54, 100, 176, 185, 192, 208
Sse9I AATT 3 cut(s) 32, 82, 135
SspMI CTAG 2 cut(s) 173, 214
TaqI TCGA 1 cut(s) 200
TasI AATT 3 cut(s) 32, 82, 135
TfiI GAWTC 1 cut(s) 74
TscAI CASTG 1 cut(s) 95
TspGWI ACGGA 2 cut(s) 126, 180
TspRI CASTG 1 cut(s) 95
XceI RCATGY 1 cut(s) 14
XspI CTAG 2 cut(s) 173, 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.