Rroxscaffold_5G00358130

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0002857
Physical Location & Seq
Forward (+)
38159584 .. 38160799
1216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00358130.1

Sequence Viewer

Length: 189 bp
ATGGTCAAGGGTTGGTTACTAATGATCGAGTATTTATTAGGTGTTTACATGACTGATTGCGGTGGAAATACAACTGTCTTAAATCGAATCCCTGTTTGGAAAAGAAGAACTGTAAGGGACTATATTTTGGATCTGTTTGGACACGAATTGGTTGTACTGATCGATGTTATGGTTTTACAAAGTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.23

Weight (kDa)

6.52

Isoelectric Point (pI)

56.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 60
AclWI GGATC 1 cut(s) 138
AfaI GTAC 1 cut(s) 156
AjuI GAANNNNNNNTTGG 2 cut(s) 79, 111
AlwI GGATC 1 cut(s) 138
Bsa29I ATCGAT 1 cut(s) 162
BseCI ATCGAT 1 cut(s) 162
BshVI ATCGAT 1 cut(s) 162
BslFI GGGAC 1 cut(s) 131
BsmFI GGGAC 1 cut(s) 131
Bsp143I GATC 3 cut(s) 24, 130, 159
BspACI CCGC 1 cut(s) 60
BspDI ATCGAT 1 cut(s) 162
BspPI GGATC 1 cut(s) 138
BssMI GATC 3 cut(s) 24, 130, 159
Bst4CI ACNGT 2 cut(s) 76, 112
BstKTI GATC 3 cut(s) 27, 133, 162
BstMBI GATC 3 cut(s) 24, 130, 159
BstX2I RGATCY 1 cut(s) 130
BstYI RGATCY 1 cut(s) 130
Bsu15I ATCGAT 1 cut(s) 162
BsuTUI ATCGAT 1 cut(s) 162
ClaI ATCGAT 1 cut(s) 162
Csp6I GTAC 1 cut(s) 155
CviAII CATG 1 cut(s) 49
CviQI GTAC 1 cut(s) 155
DpnI GATC 3 cut(s) 26, 132, 161
DpnII GATC 3 cut(s) 24, 130, 159
FaeI CATG 1 cut(s) 52
FaiI YATR 4 cut(s) 50, 123, 170, 185
FaqI GGGAC 1 cut(s) 131
FatI CATG 1 cut(s) 48
Hin1II CATG 1 cut(s) 52
HinfI GANTC 1 cut(s) 87
Hpy166II GTNNAC 1 cut(s) 46
Hpy8I GTNNAC 1 cut(s) 46
HpyCH4III ACNGT 2 cut(s) 76, 112
Hsp92II CATG 1 cut(s) 52
Kzo9I GATC 3 cut(s) 24, 130, 159
LpnPI CCDG 1 cut(s) 105
MaeIII GTNAC 1 cut(s) 15
MalI GATC 3 cut(s) 26, 132, 161
MboI GATC 3 cut(s) 24, 130, 159
MboII GAAGA 1 cut(s) 117
MflI RGATCY 1 cut(s) 130
MluCI AATT 1 cut(s) 146
MseI TTAA 1 cut(s) 80
NdeII GATC 3 cut(s) 24, 130, 159
NlaIII CATG 1 cut(s) 52
PfeI GAWTC 1 cut(s) 87
PsuI RGATCY 1 cut(s) 130
RsaI GTAC 1 cut(s) 156
RsaNI GTAC 1 cut(s) 155
SaqAI TTAA 1 cut(s) 80
Sau3AI GATC 3 cut(s) 24, 130, 159
SetI ASST 1 cut(s) 43
SgeI CNNG 5 cut(s) 19, 40, 61, 104, 155
Sse9I AATT 1 cut(s) 146
SsiI CCGC 1 cut(s) 60
TaaI ACNGT 2 cut(s) 76, 112
TaqI TCGA 3 cut(s) 27, 85, 162
TasI AATT 1 cut(s) 146
TatI WGTACW 1 cut(s) 154
TfiI GAWTC 1 cut(s) 87
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.