RchiOBHm_Chr4g0401261

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0002857
Physical Location & Seq
Reverse (-)
19287841 .. 19288570
730 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37320

Sequence Viewer

Length: 180 bp
ATGTTAATAGCATTAATCTCTATACTTTCTTTGTATCTTGGAGTAAAGAAGAAGAAAAGAAGTAAAAGAGGGATTGAAAAGCAAAATCGGGAAATCTGCCTGTGCAGATCAGTTAACTTCGACAGAGCACTGAGACCAGCTCAGAACGATCCAGAGAATGATCTTTATATTGATGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2

Protein Analysis

59

Amino Acids

6.8

Weight (kDa)

9.62

Isoelectric Point (pI)

64.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 143
AgsI TTSAA 1 cut(s) 77
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
Alw21I GWGCWC 1 cut(s) 130
Alw26I GTCTC 1 cut(s) 127
AlwI GGATC 1 cut(s) 143
AseI ATTAAT 1 cut(s) 14
Bbv12I GWGCWC 1 cut(s) 130
BccI CCATC 1 cut(s) 167
BcoDI GTCTC 1 cut(s) 127
BplI GAGNNNNNCTC 2 cut(s) 124, 156
BsaI GGTCTC 1 cut(s) 127
BseMII CTCAG 2 cut(s) 122, 155
BsgI GTGCAG 1 cut(s) 124
BsiHKAI GWGCWC 1 cut(s) 130
BsmAI GTCTC 1 cut(s) 127
Bso31I GGTCTC 1 cut(s) 127
Bsp1286I GDGCHC 1 cut(s) 130
Bsp143I GATC 3 cut(s) 107, 148, 160
BspCNI CTCAG 2 cut(s) 123, 154
BspPI GGATC 1 cut(s) 143
BspTNI GGTCTC 1 cut(s) 127
BssMI GATC 3 cut(s) 107, 148, 160
BstDEI CTNAG 2 cut(s) 131, 141
BstKTI GATC 3 cut(s) 110, 151, 163
BstMAI GTCTC 1 cut(s) 127
BstMBI GATC 3 cut(s) 107, 148, 160
BtsIMutI CAGTG 1 cut(s) 128
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
DdeI CTNAG 2 cut(s) 131, 141
DpnI GATC 3 cut(s) 109, 150, 162
DpnII GATC 3 cut(s) 107, 148, 160
Eco31I GGTCTC 1 cut(s) 127
FaiI YATR 2 cut(s) 23, 168
FspEI CC 9 cut(s) 24, 54, 55, 73, 74, 113, 150, 159, 165
HincII GTYRAC 1 cut(s) 115
HindII GTYRAC 1 cut(s) 115
HpaI GTTAAC 1 cut(s) 115
Hpy166II GTNNAC 1 cut(s) 115
Hpy188I TCNGA 1 cut(s) 144
Hpy188III TCNNGA 2 cut(s) 89, 152
Hpy8I GTNNAC 1 cut(s) 115
HpyCH4V TGCA 1 cut(s) 105
HpyF3I CTNAG 2 cut(s) 131, 141
KspAI GTTAAC 1 cut(s) 115
Kzo9I GATC 3 cut(s) 107, 148, 160
LpnPI CCDG 3 cut(s) 113, 150, 165
MalI GATC 3 cut(s) 109, 150, 162
MboI GATC 3 cut(s) 107, 148, 160
MboII GAAGA 2 cut(s) 61, 64
MhlI GDGCHC 1 cut(s) 130
MnlI CCTC 1 cut(s) 62
MseI TTAA 3 cut(s) 5, 14, 114
NdeII GATC 3 cut(s) 107, 148, 160
PshBI ATTAAT 1 cut(s) 14
SaqAI TTAA 3 cut(s) 5, 14, 114
Sau3AI GATC 3 cut(s) 107, 148, 160
SduI GDGCHC 1 cut(s) 130
SetI ASST 1 cut(s) 142
SgeI CNNG 5 cut(s) 50, 101, 112, 149, 164
TaqI TCGA 1 cut(s) 120
Tru1I TTAA 3 cut(s) 5, 14, 114
Tru9I TTAA 3 cut(s) 5, 14, 114
TscAI CASTG 1 cut(s) 135
TspRI CASTG 1 cut(s) 135
VspI ATTAAT 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.