RchiOBHm_Chr5g0070441

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
76161845 .. 76162746
902 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34567

Sequence Viewer

Length: 192 bp
ATGGTCGATTTAGTACAGCAAGGTCGGGCAGTCCGAGAATCTGACACTTTGACGGAAATCCATGATTTGAGGCCCGAATTCCTTGTAGAAGCCCACCGACGAGTATTAACTGAATATCTCTATTCATTAGAGATATATGACATATTTTTATGGGTGAAAATTATTAGGAATCTTAGAGGAGAAGCTACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.53

Weight (kDa)

5.21

Isoelectric Point (pI)

48.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 77
AfaI GTAC 1 cut(s) 15
AluBI AGCT 1 cut(s) 185
AluI AGCT 1 cut(s) 185
AoxI GGCC 1 cut(s) 71
ApoI RAATTY 1 cut(s) 77
AspS9I GGNCC 1 cut(s) 72
AsuHPI GGTGA 1 cut(s) 166
BmgT120I GGNCC 1 cut(s) 72
BseRI GAGGAG 1 cut(s) 192
BshFI GGCC 1 cut(s) 73
BsnI GGCC 1 cut(s) 73
BspANI GGCC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 173
BsuRI GGCC 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 72
Csp6I GTAC 1 cut(s) 14
CviAII CATG 1 cut(s) 62
CviJI RGCY 3 cut(s) 73, 92, 185
CviKI_1 RGCY 3 cut(s) 73, 92, 185
CviQI GTAC 1 cut(s) 14
DdeI CTNAG 1 cut(s) 173
EcoRI GAATTC 1 cut(s) 77
FaeI CATG 1 cut(s) 65
FaiI YATR 5 cut(s) 63, 136, 138, 143, 151
FatI CATG 1 cut(s) 61
HaeIII GGCC 1 cut(s) 73
Hin1II CATG 1 cut(s) 65
HinfI GANTC 2 cut(s) 38, 169
HphI GGTGA 1 cut(s) 166
Hpy188I TCNGA 2 cut(s) 35, 43
Hpy99I CGWCG 1 cut(s) 102
HpyF3I CTNAG 1 cut(s) 173
Hsp92II CATG 1 cut(s) 65
MluCI AATT 2 cut(s) 77, 159
MnlI CCTC 2 cut(s) 63, 170
MseI TTAA 1 cut(s) 107
NlaIII CATG 1 cut(s) 65
PcsI WCGNNNNNNNCGW 1 cut(s) 31
PfeI GAWTC 2 cut(s) 38, 169
PspPI GGNCC 1 cut(s) 72
RsaI GTAC 1 cut(s) 15
RsaNI GTAC 1 cut(s) 14
SaqAI TTAA 1 cut(s) 107
Sau96I GGNCC 1 cut(s) 72
SetI ASST 2 cut(s) 25, 187
SgeI CNNG 7 cut(s) 32, 38, 47, 74, 86, 95, 113
Sse9I AATT 2 cut(s) 77, 159
TaqI TCGA 1 cut(s) 6
TasI AATT 2 cut(s) 77, 159
TatI WGTACW 1 cut(s) 13
TfiI GAWTC 2 cut(s) 38, 169
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
TspDTI ATGAA 1 cut(s) 114
TspGWI ACGGA 1 cut(s) 68
XapI RAATTY 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.