RchiOBHm_Chr7g0222111

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0002857
Physical Location & Seq
Reverse (-)
43214639 .. 43217408
2770 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19876

Sequence Viewer

Length: 210 bp
ATGGGGCTAGGAAACCTGAGAGCACTAGGAGAAAAGACGCATGAAAGGCCAAATCAGGAAATCTGCCTGTACAAGTCAGTCAACTTCGATAGATCATTGAGAGTAGCTCAAAACGAACTAGATGATGATCTTTATATAATTATATTTTTGGAAAGCCTCGAATGTCTAGTTTCCAGAGCTTTTTACGGCTTATCAATATCATTTTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.97

Weight (kDa)

4.91

Isoelectric Point (pI)

46.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 71
AluBI AGCT 2 cut(s) 107, 179
AluI AGCT 2 cut(s) 107, 179
Alw21I GWGCWC 1 cut(s) 25
AoxI GGCC 1 cut(s) 47
Bbv12I GWGCWC 1 cut(s) 25
BceAI ACGGC 1 cut(s) 202
BfaI CTAG 5 cut(s) 8, 26, 119, 167, 208
BplI GAGNNNNNCTC 2 cut(s) 91, 123
BsaBI GATNNNNATC 1 cut(s) 126
Bse8I GATNNNNATC 1 cut(s) 126
BseJI GATNNNNATC 1 cut(s) 126
BseMII CTCAG 1 cut(s) 8
BshFI GGCC 1 cut(s) 49
BsiHKAI GWGCWC 1 cut(s) 25
BsnI GGCC 1 cut(s) 49
Bsp1286I GDGCHC 1 cut(s) 25
Bsp1407I TGTACA 1 cut(s) 69
Bsp143I GATC 2 cut(s) 92, 127
BspANI GGCC 1 cut(s) 49
BspCNI CTCAG 1 cut(s) 9
BsrGI TGTACA 1 cut(s) 69
BssMI GATC 2 cut(s) 92, 127
BstAUI TGTACA 1 cut(s) 69
BstDEI CTNAG 1 cut(s) 17
BstKTI GATC 2 cut(s) 95, 130
BstMBI GATC 2 cut(s) 92, 127
BstMWI GCNNNNNNNGC 1 cut(s) 46
BsuRI GGCC 1 cut(s) 49
CseI GACGC 1 cut(s) 46
Csp6I GTAC 1 cut(s) 70
CviAII CATG 1 cut(s) 41
CviJI RGCY 6 cut(s) 7, 49, 107, 156, 179, 189
CviKI_1 RGCY 6 cut(s) 7, 49, 107, 156, 179, 189
CviQI GTAC 1 cut(s) 70
DdeI CTNAG 1 cut(s) 17
DpnI GATC 2 cut(s) 94, 129
DpnII GATC 2 cut(s) 92, 127
FaeI CATG 1 cut(s) 44
FaiI YATR 4 cut(s) 42, 135, 137, 143
FatI CATG 1 cut(s) 40
FspBI CTAG 5 cut(s) 8, 26, 119, 167, 208
HaeIII GGCC 1 cut(s) 49
HgaI GACGC 1 cut(s) 46
Hin1II CATG 1 cut(s) 44
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
Hpy166II GTNNAC 1 cut(s) 82
Hpy188III TCNNGA 2 cut(s) 56, 174
Hpy8I GTNNAC 1 cut(s) 82
HpyF10VI GCNNNNNNNGC 1 cut(s) 46
HpyF3I CTNAG 1 cut(s) 17
Hsp92II CATG 1 cut(s) 44
Kzo9I GATC 2 cut(s) 92, 127
LpnPI CCDG 4 cut(s) 29, 41, 80, 187
MaeI CTAG 5 cut(s) 8, 26, 119, 167, 208
MalI GATC 2 cut(s) 94, 129
MboI GATC 2 cut(s) 92, 127
MhlI GDGCHC 1 cut(s) 25
MluCI AATT 1 cut(s) 138
MnlI CCTC 1 cut(s) 167
MwoI GCNNNNNNNGC 1 cut(s) 46
NdeII GATC 2 cut(s) 92, 127
NlaIII CATG 1 cut(s) 44
RsaI GTAC 1 cut(s) 71
RsaNI GTAC 1 cut(s) 70
Sau3AI GATC 2 cut(s) 92, 127
SduI GDGCHC 1 cut(s) 25
SetI ASST 3 cut(s) 18, 109, 181
Sse9I AATT 1 cut(s) 138
SspMI CTAG 5 cut(s) 8, 26, 119, 167, 208
TaqI TCGA 2 cut(s) 87, 159
TasI AATT 1 cut(s) 138
TatI WGTACW 1 cut(s) 69
TspDTI ATGAA 1 cut(s) 57
XspI CTAG 5 cut(s) 8, 26, 119, 167, 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.