Rroxscaffold_2G00095380

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
16749091 .. 16750207
1117 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00095380.1

Sequence Viewer

Length: 195 bp
ATGGTTAATAGGGCAGTGATTTGGTACTGTTATTATAGTTTTGAAGGCTATGAAGAAATCGAGTTGGTGTCAAAGGATATCGAAGAACAGAATTCATTGTGGAAAAGAAGAATGGTAAGGGTTGGATATTTGGATCTATTTGGTCGTGTATTGTTTGTACTGATTGAAGTTAAGGTTTCACCAAGTGCAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.65

Weight (kDa)

5.29

Isoelectric Point (pI)

69.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 141
AcsI RAATTY 1 cut(s) 91
AdeI CACNNNGTG 1 cut(s) 185
AfaI GTAC 2 cut(s) 26, 159
AgsI TTSAA 2 cut(s) 44, 167
AlwI GGATC 1 cut(s) 141
ApoI RAATTY 1 cut(s) 91
AsuHPI GGTGA 1 cut(s) 171
Bsp143I GATC 1 cut(s) 133
BspPI GGATC 1 cut(s) 141
BssMI GATC 1 cut(s) 133
Bst4CI ACNGT 1 cut(s) 29
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BstX2I RGATCY 1 cut(s) 133
BstYI RGATCY 1 cut(s) 133
BtsI GCAGTG 1 cut(s) 21
BtsIMutI CAGTG 1 cut(s) 21
Csp6I GTAC 2 cut(s) 25, 158
CviJI RGCY 1 cut(s) 48
CviKI_1 RGCY 1 cut(s) 48
CviQI GTAC 2 cut(s) 25, 158
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
DraIII CACNNNGTG 1 cut(s) 185
Eco32I GATATC 1 cut(s) 79
EcoRI GAATTC 1 cut(s) 91
EcoRV GATATC 1 cut(s) 79
FaiI YATR 2 cut(s) 36, 51
HphI GGTGA 1 cut(s) 171
HpyAV CCTTC 1 cut(s) 38
HpyCH4III ACNGT 1 cut(s) 29
HpyCH4V TGCA 1 cut(s) 188
Kzo9I GATC 1 cut(s) 133
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MboII GAAGA 3 cut(s) 65, 95, 120
MflI RGATCY 1 cut(s) 133
MluCI AATT 2 cut(s) 91, 190
MmeI TCCRAC 1 cut(s) 103
MseI TTAA 3 cut(s) 6, 171, 193
NdeII GATC 1 cut(s) 133
PsuI RGATCY 1 cut(s) 133
RsaI GTAC 2 cut(s) 26, 159
RsaNI GTAC 2 cut(s) 25, 158
SaqAI TTAA 3 cut(s) 6, 171, 193
Sau3AI GATC 1 cut(s) 133
SetI ASST 1 cut(s) 177
SgeI CNNG 2 cut(s) 73, 158
Sse9I AATT 2 cut(s) 91, 190
TaaI ACNGT 1 cut(s) 29
TaqI TCGA 2 cut(s) 60, 81
TasI AATT 2 cut(s) 91, 190
TatI WGTACW 1 cut(s) 157
Tru1I TTAA 3 cut(s) 6, 171, 193
Tru9I TTAA 3 cut(s) 6, 171, 193
TscAI CASTG 1 cut(s) 21
TspDTI ATGAA 2 cut(s) 66, 84
TspRI CASTG 1 cut(s) 21
XapI RAATTY 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.