RchiOBHm_Chr5g0001121

Belongs to the eukaryotic ribosomal protein eS6 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
599086 .. 599787
702 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28258

Sequence Viewer

Length: 264 bp
ATGCACAGATTGCGAGGAGCCTCATGCTTCCAAGGACATGGAAGGAGGAATTGTGAGCGAAGAAGGAAATCTGTTCATGGATGCATTGTTAGTCCAGACCTGTTTGTGTTGAACTTGGTCATTGTTAAGAAAGGTGACAATGACCTTCCTGGACTGACTAATGTTGAAAAGCCAACAGTGAGAGTTCCAAAGAGGGCTTCCAAGATCCACAAGCTATTTAACCTCACCAGGGACGATGATGGTAGGAAGTATGTCAACACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.94

Weight (kDa)

10.48

Isoelectric Point (pI)

46.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S6e PF01092 6 - 54 4.4e-13 Ribosomal protein S6e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 199
AfiI CCNNNNNNNGG 1 cut(s) 229
AgsI TTSAA 2 cut(s) 112, 167
AjnI CCWGG 2 cut(s) 148, 227
AjuI GAANNNNNNNTTGG 2 cut(s) 181, 213
AluBI AGCT 1 cut(s) 214
AluI AGCT 1 cut(s) 214
AlwI GGATC 1 cut(s) 199
AsuHPI GGTGA 2 cut(s) 146, 217
BccI CCATC 1 cut(s) 233
BciT130I CCWGG 2 cut(s) 150, 229
Bme1390I CCNGG 2 cut(s) 150, 229
BmiI GGNNCC 1 cut(s) 19
BmrFI CCNGG 2 cut(s) 150, 229
BmsI GCATC 1 cut(s) 71
BsaJI CCNNGG 2 cut(s) 31, 228
BsaXI ACNNNNNCTCC 2 cut(s) 37, 67
Bsc4I CCNNNNNNNGG 1 cut(s) 229
BseBI CCWGG 2 cut(s) 150, 229
BseDI CCNNGG 2 cut(s) 31, 228
BseGI GGATG 1 cut(s) 86
BseLI CCNNNNNNNGG 1 cut(s) 229
BseRI GAGGAG 1 cut(s) 30
BslFI GGGAC 1 cut(s) 245
BslI CCNNNNNNNGG 1 cut(s) 229
BsmFI GGGAC 1 cut(s) 245
Bsp143I GATC 1 cut(s) 204
BspLI GGNNCC 1 cut(s) 19
BspPI GGATC 1 cut(s) 199
BssECI CCNNGG 2 cut(s) 31, 228
BssMI GATC 1 cut(s) 204
BssT1I CCWWGG 1 cut(s) 31
Bst2UI CCWGG 2 cut(s) 150, 229
Bst4CI ACNGT 1 cut(s) 178
BstAPI GCANNNNNTGC 1 cut(s) 10
BstF5I GGATG 1 cut(s) 86
BstKTI GATC 1 cut(s) 207
BstMBI GATC 1 cut(s) 204
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstNI CCWGG 2 cut(s) 150, 229
BstSCI CCNGG 2 cut(s) 148, 227
BstX2I RGATCY 1 cut(s) 204
BstXI CCANNNNNNTGG 1 cut(s) 38
BstYI RGATCY 1 cut(s) 204
BtsCI GGATG 1 cut(s) 86
BtsIMutI CAGTG 1 cut(s) 183
CviAII CATG 3 cut(s) 24, 38, 77
CviJI RGCY 4 cut(s) 20, 172, 197, 214
CviKI_1 RGCY 4 cut(s) 20, 172, 197, 214
DpnI GATC 1 cut(s) 206
DpnII GATC 1 cut(s) 204
Eco130I CCWWGG 1 cut(s) 31
EcoRII CCWGG 2 cut(s) 148, 227
EcoT14I CCWWGG 1 cut(s) 31
EcoT22I ATGCAT 1 cut(s) 86
ErhI CCWWGG 1 cut(s) 31
FaeI CATG 3 cut(s) 27, 41, 80
FaiI YATR 4 cut(s) 25, 39, 78, 252
FaqI GGGAC 1 cut(s) 245
FatI CATG 3 cut(s) 23, 37, 76
FokI GGATG 1 cut(s) 93
Hin1II CATG 3 cut(s) 27, 41, 80
HincII GTYRAC 1 cut(s) 256
HindII GTYRAC 1 cut(s) 256
HphI GGTGA 2 cut(s) 146, 217
Hpy166II GTNNAC 1 cut(s) 256
Hpy188III TCNNGA 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 256
HpyAV CCTTC 3 cut(s) 36, 57, 155
HpyCH4III ACNGT 1 cut(s) 178
HpyCH4V TGCA 2 cut(s) 4, 84
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
Hsp92II CATG 3 cut(s) 27, 41, 80
Kzo9I GATC 1 cut(s) 204
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 6 cut(s) 108, 113, 135, 162, 214, 241
LweI GCATC 1 cut(s) 71
MaeIII GTNAC 1 cut(s) 134
MalI GATC 1 cut(s) 206
MboI GATC 1 cut(s) 204
MboII GAAGA 1 cut(s) 72
MflI RGATCY 1 cut(s) 204
MluCI AATT 1 cut(s) 49
MnlI CCTC 5 cut(s) 8, 31, 39, 186, 233
Mph1103I ATGCAT 1 cut(s) 86
MseI TTAA 3 cut(s) 126, 219, 262
MspR9I CCNGG 2 cut(s) 150, 229
MvaI CCWGG 2 cut(s) 150, 229
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeII GATC 1 cut(s) 204
NlaIII CATG 3 cut(s) 27, 41, 80
NlaIV GGNNCC 1 cut(s) 19
NmuCI GTSAC 1 cut(s) 134
NsiI ATGCAT 1 cut(s) 86
PfoI TCCNGGA 1 cut(s) 148
Psp6I CCWGG 2 cut(s) 148, 227
PspGI CCWGG 2 cut(s) 148, 227
PspN4I GGNNCC 1 cut(s) 19
PsuI RGATCY 1 cut(s) 204
SaqAI TTAA 3 cut(s) 126, 219, 262
Sau3AI GATC 1 cut(s) 204
ScrFI CCNGG 2 cut(s) 150, 229
SetI ASST 5 cut(s) 102, 136, 147, 216, 225
SfaNI GCATC 1 cut(s) 71
Sse9I AATT 1 cut(s) 49
StyD4I CCNGG 2 cut(s) 148, 227
StyI CCWWGG 1 cut(s) 31
TaaI ACNGT 1 cut(s) 178
TasI AATT 1 cut(s) 49
Tru1I TTAA 3 cut(s) 126, 219, 262
Tru9I TTAA 3 cut(s) 126, 219, 262
TscAI CASTG 1 cut(s) 183
TseFI GTSAC 1 cut(s) 134
Tsp45I GTSAC 1 cut(s) 134
TspDTI ATGAA 1 cut(s) 65
TspRI CASTG 1 cut(s) 183
Zsp2I ATGCAT 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.