Rroxscaffold_4G00307670

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0001589
Physical Location & Seq
Forward (+)
29116144 .. 29123157
7014 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00307670.1

Sequence Viewer

Length: 420 bp
ATGCAACCTACCTCAGAAAAGTCCTCCATGCTACCATTAAGTGCATTAACCACTGCAACACAATCGGTCTCAATGTCGACCTCTGTCATGCCTTGGCATGATCAATGCAGTAGCTCCAAAGAATTCTCTGTGCAAAAGCTAGTCAAGCTAGCATTAAGCATATATGCATGGCACAACAAAAGGGTGATCGGGCAATTCAATGTTAGCTTAATTGTTGGGAAATTAGATCAAGATTTATTTATAGTAGATCAGGAGCCTCATGCTTCTAAGGACATGGAAGGAGGAATAGTGAGCGAAGAAGGAAGTCTATTCATGGATGCATTGCAAACTATGAGAAGACCGAGAAGGAGAGTTAGCCGACCTGTTATTATAGTTGTTCCGGTACTTGGTGTGGTTGACAAAGGAGTTGGCAAGGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

139

Amino Acids

15.34

Weight (kDa)

8.82

Isoelectric Point (pI)

56.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 77
AcsI RAATTY 1 cut(s) 122
AfaI GTAC 1 cut(s) 384
AfiI CCNNNNNNNGG 1 cut(s) 386
AgsI TTSAA 1 cut(s) 199
AluBI AGCT 4 cut(s) 114, 139, 148, 207
AluI AGCT 4 cut(s) 114, 139, 148, 207
Alw26I GTCTC 1 cut(s) 73
ApoI RAATTY 1 cut(s) 122
AsuHPI GGTGA 1 cut(s) 196
AsuNHI GCTAGC 1 cut(s) 148
BbsI GAAGAC 1 cut(s) 343
BcgI CGANNNNNNTGC 2 cut(s) 45, 79
BclI TGATCA 1 cut(s) 100
BcoDI GTCTC 1 cut(s) 73
BfaI CTAG 2 cut(s) 140, 149
BmiI GGNNCC 1 cut(s) 255
BmsI GCATC 1 cut(s) 307
BmtI GCTAGC 1 cut(s) 152
BoxI GACNNNNGTC 1 cut(s) 83
BpiI GAAGAC 1 cut(s) 343
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 1 cut(s) 92
BsaWI WCCGGW 1 cut(s) 379
BsaXI ACNNNNNCTCC 2 cut(s) 273, 303
Bsc4I CCNNNNNNNGG 1 cut(s) 386
Bse3DI GCAATG 1 cut(s) 320
BseDI CCNNGG 1 cut(s) 92
BseGI GGATG 1 cut(s) 322
BseLI CCNNNNNNNGG 1 cut(s) 386
BseMI GCAATG 1 cut(s) 320
BseMII CTCAG 1 cut(s) 27
BsiSI CCGG 1 cut(s) 380
BslI CCNNNNNNNGG 1 cut(s) 386
BsmAI GTCTC 1 cut(s) 73
Bso31I GGTCTC 1 cut(s) 73
Bsp143I GATC 4 cut(s) 100, 186, 226, 247
BspCNI CTCAG 1 cut(s) 26
BspLI GGNNCC 1 cut(s) 255
BspOI GCTAGC 1 cut(s) 152
BspTNI GGTCTC 1 cut(s) 73
BsrDI GCAATG 1 cut(s) 320
BssECI CCNNGG 1 cut(s) 92
BssMI GATC 4 cut(s) 100, 186, 226, 247
BssT1I CCWWGG 1 cut(s) 92
BstC8I GCNNGC 1 cut(s) 150
BstDEI CTNAG 2 cut(s) 13, 267
BstF5I GGATG 1 cut(s) 322
BstKTI GATC 4 cut(s) 103, 189, 229, 250
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 4 cut(s) 100, 186, 226, 247
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstPAI GACNNNNGTC 1 cut(s) 83
BstV2I GAAGAC 1 cut(s) 343
BtsCI GGATG 1 cut(s) 322
BtsI GCAGTG 1 cut(s) 51
BtsIMutI CAGTG 1 cut(s) 51
Cac8I GCNNGC 1 cut(s) 150
Csp6I GTAC 1 cut(s) 383
CviAII CATG 7 cut(s) 28, 88, 98, 168, 260, 274, 313
CviJI RGCY 6 cut(s) 114, 139, 148, 207, 256, 357
CviKI_1 RGCY 6 cut(s) 114, 139, 148, 207, 256, 357
CviQI GTAC 1 cut(s) 383
DdeI CTNAG 2 cut(s) 13, 267
DpnI GATC 4 cut(s) 102, 188, 228, 249
DpnII GATC 4 cut(s) 100, 186, 226, 247
Eco130I CCWWGG 1 cut(s) 92
Eco31I GGTCTC 1 cut(s) 73
EcoRI GAATTC 1 cut(s) 122
EcoT14I CCWWGG 1 cut(s) 92
EcoT22I ATGCAT 2 cut(s) 169, 322
ErhI CCWWGG 1 cut(s) 92
FaeI CATG 7 cut(s) 31, 91, 101, 171, 263, 277, 316
FatI CATG 7 cut(s) 27, 87, 97, 167, 259, 273, 312
FbaI TGATCA 1 cut(s) 100
FblI GTMKAC 1 cut(s) 77
FokI GGATG 1 cut(s) 329
FspBI CTAG 2 cut(s) 140, 149
HapII CCGG 1 cut(s) 380
Hin1II CATG 7 cut(s) 31, 91, 101, 171, 263, 277, 316
HincII GTYRAC 2 cut(s) 78, 397
HindII GTYRAC 2 cut(s) 78, 397
HpaII CCGG 1 cut(s) 380
HphI GGTGA 1 cut(s) 196
Hpy166II GTNNAC 2 cut(s) 78, 397
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 230, 251
Hpy8I GTNNAC 2 cut(s) 78, 397
HpyAV CCTTC 3 cut(s) 272, 293, 339
HpyCH4V TGCA 8 cut(s) 4, 44, 56, 108, 133, 167, 320, 325
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpyF3I CTNAG 2 cut(s) 13, 267
Hsp92II CATG 7 cut(s) 31, 91, 101, 171, 263, 277, 316
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 4 cut(s) 100, 186, 226, 247
LmnI GCTCC 2 cut(s) 119, 253
LpnPI CCDG 3 cut(s) 236, 375, 393
LweI GCATC 1 cut(s) 307
MaeI CTAG 2 cut(s) 140, 149
MalI GATC 4 cut(s) 102, 188, 228, 249
MboI GATC 4 cut(s) 100, 186, 226, 247
MboII GAAGA 2 cut(s) 308, 348
MluCI AATT 4 cut(s) 122, 194, 210, 221
MnlI CCTC 5 cut(s) 22, 34, 91, 267, 275
Mph1103I ATGCAT 2 cut(s) 169, 322
MseI TTAA 4 cut(s) 38, 47, 155, 209
MspI CCGG 1 cut(s) 380
MwoI GCNNNNNNNGC 1 cut(s) 145
NdeII GATC 4 cut(s) 100, 186, 226, 247
NheI GCTAGC 1 cut(s) 148
NlaIII CATG 7 cut(s) 31, 91, 101, 171, 263, 277, 316
NlaIV GGNNCC 1 cut(s) 255
NsiI ATGCAT 2 cut(s) 169, 322
PshAI GACNNNNGTC 1 cut(s) 83
PspN4I GGNNCC 1 cut(s) 255
RsaI GTAC 1 cut(s) 384
RsaNI GTAC 1 cut(s) 383
SalI GTCGAC 1 cut(s) 76
SaqAI TTAA 4 cut(s) 38, 47, 155, 209
Sau3AI GATC 4 cut(s) 100, 186, 226, 247
SetI ASST 8 cut(s) 10, 14, 83, 116, 141, 150, 209, 364
SfaNI GCATC 1 cut(s) 307
Sse9I AATT 4 cut(s) 122, 194, 210, 221
SspMI CTAG 2 cut(s) 140, 149
StyI CCWWGG 1 cut(s) 92
TaqI TCGA 1 cut(s) 77
TaqII GACCGA 2 cut(s) 55, 355
TasI AATT 4 cut(s) 122, 194, 210, 221
Tru1I TTAA 4 cut(s) 38, 47, 155, 209
Tru9I TTAA 4 cut(s) 38, 47, 155, 209
TscAI CASTG 1 cut(s) 58
TspDTI ATGAA 1 cut(s) 301
TspRI CASTG 1 cut(s) 58
XapI RAATTY 1 cut(s) 122
XmiI GTMKAC 1 cut(s) 77
XspI CTAG 2 cut(s) 140, 149
Zsp2I ATGCAT 2 cut(s) 169, 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.