Rmu_sc0001758.1_g000027

Belongs to the eukaryotic ribosomal protein eS6 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001758.1
Physical Location & Seq
Forward (+)
163318 .. 164636
1319 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001758.1_g000027.1.cds

Sequence Viewer

Length: 384 bp
atggaatttattttcttggtcactagcaggtatgatactgctgcaacactggagctttctcaagcagaacataaggagcggaaagcaagggccttagctgcagctgccatggagttggaaagacttctcagaaaggaagattttggactcaggagttatgtgttcaaaattatgggaggctgtgacaagaaattgtttccttcgaagcaaggagtgttaaccccagggtgtgtttgccgtttgctccacaggggtgactgtgaccttcctggactgactgatgttgaaaagccaacagtgagaggtccaaagagggcttccaagatccgcaagctatttaacctcaccaaggatgatgatgttaggaagtatgtcaacacttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.4

Weight (kDa)

9.51

Isoelectric Point (pI)

26.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 18
AccBSI CCGCTC 1 cut(s) 79
AciI CCGC 2 cut(s) 79, 328
AclWI GGATC 1 cut(s) 319
AcsI RAATTY 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 349
AgsI TTSAA 2 cut(s) 166, 287
AjnI CCWGG 2 cut(s) 223, 268
AjuI GAANNNNNNNTTGG 2 cut(s) 301, 333
AleI CACNNNNGTG 1 cut(s) 252
AluBI AGCT 4 cut(s) 55, 98, 104, 334
AluI AGCT 4 cut(s) 55, 98, 104, 334
AlwI GGATC 1 cut(s) 319
AoxI GGCC 1 cut(s) 90
ApeKI GCWGC 4 cut(s) 41, 98, 101, 104
ApoI RAATTY 1 cut(s) 5
Asp700I GAANNNNTTC 1 cut(s) 123
AspS9I GGNCC 2 cut(s) 90, 305
AsuHPI GGTGA 2 cut(s) 266, 337
AsuII TTCGAA 1 cut(s) 203
AvaII GGWCC 1 cut(s) 305
BbvI GCAGC 4 cut(s) 28, 85, 91, 113
BceAI ACGGC 1 cut(s) 222
BciT130I CCWGG 2 cut(s) 225, 270
BfaI CTAG 1 cut(s) 24
BfmI CTRYAG 1 cut(s) 99
BfuAI ACCTGC 1 cut(s) 18
BisI GCNGC 4 cut(s) 42, 99, 102, 105
BlsI GCNGC 4 cut(s) 43, 100, 103, 106
Bme1390I CCNGG 2 cut(s) 225, 270
Bme18I GGWCC 1 cut(s) 305
BmgT120I GGNCC 2 cut(s) 90, 305
BmrFI CCNGG 2 cut(s) 225, 270
BpmI CTGGAG 1 cut(s) 71
Bpu10I CCTNAGC 1 cut(s) 94
Bpu14I TTCGAA 1 cut(s) 203
BpuEI CTTGAG 1 cut(s) 45
BsaJI CCNNGG 4 cut(s) 108, 223, 224, 348
Bsc4I CCNNNNNNNGG 1 cut(s) 349
Bse1I ACTGG 1 cut(s) 54
BseBI CCWGG 2 cut(s) 225, 270
BseDI CCNNGG 4 cut(s) 108, 223, 224, 348
BseGI GGATG 1 cut(s) 358
BseLI CCNNNNNNNGG 1 cut(s) 349
BseMII CTCAG 2 cut(s) 142, 163
BseNI ACTGG 1 cut(s) 54
BseXI GCAGC 4 cut(s) 28, 85, 91, 113
BshFI GGCC 1 cut(s) 92
BslI CCNNNNNNNGG 1 cut(s) 349
BsnI GGCC 1 cut(s) 92
Bsp119I TTCGAA 1 cut(s) 203
Bsp143I GATC 1 cut(s) 324
Bsp19I CCATGG 1 cut(s) 108
BspACI CCGC 2 cut(s) 79, 328
BspANI GGCC 1 cut(s) 92
BspCNI CTCAG 2 cut(s) 141, 162
BspMAI CTGCAG 1 cut(s) 103
BspMI ACCTGC 1 cut(s) 18
BspPI GGATC 1 cut(s) 319
BspT104I TTCGAA 1 cut(s) 203
BsrBI CCGCTC 1 cut(s) 79
BsrI ACTGG 1 cut(s) 54
BssECI CCNNGG 4 cut(s) 108, 223, 224, 348
BssMI GATC 1 cut(s) 324
BssT1I CCWWGG 2 cut(s) 108, 348
Bst2UI CCWGG 2 cut(s) 225, 270
Bst4CI ACNGT 2 cut(s) 260, 298
BstBI TTCGAA 1 cut(s) 203
BstC8I GCNNGC 1 cut(s) 332
BstDEI CTNAG 3 cut(s) 94, 128, 149
BstDSI CCRYGG 1 cut(s) 108
BstENI CCTNNNNNAGG 1 cut(s) 347
BstF5I GGATG 1 cut(s) 358
BstKTI GATC 1 cut(s) 327
BstMBI GATC 1 cut(s) 324
BstMWI GCNNNNNNNGC 2 cut(s) 98, 104
BstNI CCWGG 2 cut(s) 225, 270
BstSCI CCNGG 2 cut(s) 223, 268
BstSFI CTRYAG 1 cut(s) 99
BstV1I GCAGC 4 cut(s) 28, 85, 91, 113
BstX2I RGATCY 1 cut(s) 324
BstXI CCANNNNNNTGG 1 cut(s) 115
BstYI RGATCY 1 cut(s) 324
BsuRI GGCC 1 cut(s) 92
BtgI CCRYGG 1 cut(s) 108
BtsCI GGATG 1 cut(s) 358
BtsIMutI CAGTG 2 cut(s) 47, 303
BveI ACCTGC 1 cut(s) 18
Cac8I GCNNGC 1 cut(s) 332
Cfr13I GGNCC 2 cut(s) 90, 305
CviAII CATG 1 cut(s) 109
CviJI RGCY 8 cut(s) 55, 92, 98, 104, 180, 292, 317, 334
CviKI_1 RGCY 8 cut(s) 55, 92, 98, 104, 180, 292, 317, 334
DdeI CTNAG 3 cut(s) 94, 128, 149
DpnI GATC 1 cut(s) 326
DpnII GATC 1 cut(s) 324
Eco130I CCWWGG 2 cut(s) 108, 348
Eco47I GGWCC 1 cut(s) 305
EcoNI CCTNNNNNAGG 1 cut(s) 347
EcoO109I RGGNCCY 1 cut(s) 90
EcoRII CCWGG 2 cut(s) 223, 268
EcoT14I CCWWGG 2 cut(s) 108, 348
ErhI CCWWGG 2 cut(s) 108, 348
FaeI CATG 1 cut(s) 112
FaiI YATR 6 cut(s) 33, 72, 110, 159, 173, 372
FatI CATG 1 cut(s) 108
Fnu4HI GCNGC 4 cut(s) 42, 99, 102, 105
FokI GGATG 1 cut(s) 365
Fsp4HI GCNGC 4 cut(s) 42, 99, 102, 105
FspBI CTAG 1 cut(s) 24
GluI GCNGC 4 cut(s) 42, 99, 102, 105
GsuI CTGGAG 1 cut(s) 71
HaeIII GGCC 1 cut(s) 92
Hin1II CATG 1 cut(s) 112
HincII GTYRAC 2 cut(s) 219, 376
HindII GTYRAC 2 cut(s) 219, 376
HinfI GANTC 1 cut(s) 147
HpaI GTTAAC 1 cut(s) 219
HphI GGTGA 2 cut(s) 266, 337
Hpy166II GTNNAC 2 cut(s) 219, 376
Hpy188I TCNGA 1 cut(s) 131
Hpy188III TCNNGA 1 cut(s) 151
Hpy8I GTNNAC 2 cut(s) 219, 376
HpyAV CCTTC 2 cut(s) 210, 275
HpyCH4III ACNGT 2 cut(s) 260, 298
HpyCH4V TGCA 2 cut(s) 44, 101
HpyF10VI GCNNNNNNNGC 2 cut(s) 98, 104
HpyF3I CTNAG 3 cut(s) 94, 128, 149
Hsp92II CATG 1 cut(s) 112
KspAI GTTAAC 1 cut(s) 219
Kzo9I GATC 1 cut(s) 324
LmnI GCTCC 3 cut(s) 52, 76, 249
LpnPI CCDG 8 cut(s) 13, 35, 136, 210, 235, 237, 255, 282
Lsp1109I GCAGC 4 cut(s) 28, 85, 91, 113
MaeI CTAG 1 cut(s) 24
MaeIII GTNAC 4 cut(s) 19, 182, 254, 260
MalI GATC 1 cut(s) 326
MbiI CCGCTC 1 cut(s) 79
MboI GATC 1 cut(s) 324
MboII GAAGA 1 cut(s) 149
MflI RGATCY 1 cut(s) 324
MluCI AATT 3 cut(s) 5, 168, 191
MlyI GAGTC 1 cut(s) 141
MmeI TCCRAC 1 cut(s) 96
MnlI CCTC 4 cut(s) 170, 296, 306, 353
MroXI GAANNNNTTC 1 cut(s) 123
MseI TTAA 3 cut(s) 218, 339, 382
MslI CAYNNNNRTG 1 cut(s) 252
MspA1I CMGCKG 1 cut(s) 104
MspR9I CCNGG 2 cut(s) 225, 270
MvaI CCWGG 2 cut(s) 225, 270
MwoI GCNNNNNNNGC 2 cut(s) 98, 104
NcoI CCATGG 1 cut(s) 108
NdeII GATC 1 cut(s) 324
NlaIII CATG 1 cut(s) 112
NmuCI GTSAC 4 cut(s) 19, 182, 254, 260
NspV TTCGAA 1 cut(s) 203
OliI CACNNNNGTG 1 cut(s) 252
PasI CCCWGGG 1 cut(s) 224
PdmI GAANNNNTTC 1 cut(s) 123
PfoI TCCNGGA 1 cut(s) 268
PkrI GCNGC 4 cut(s) 43, 100, 103, 106
PleI GAGTC 1 cut(s) 141
PpsI GAGTC 1 cut(s) 141
Psp6I CCWGG 2 cut(s) 223, 268
PspGI CCWGG 2 cut(s) 223, 268
PspPI GGNCC 2 cut(s) 90, 305
PstI CTGCAG 1 cut(s) 103
PsuI RGATCY 1 cut(s) 324
PvuII CAGCTG 1 cut(s) 104
RseI CAYNNNNRTG 1 cut(s) 252
SaqAI TTAA 3 cut(s) 218, 339, 382
SatI GCNGC 4 cut(s) 42, 99, 102, 105
Sau3AI GATC 1 cut(s) 324
Sau96I GGNCC 2 cut(s) 90, 305
SchI GAGTC 1 cut(s) 141
ScrFI CCNGG 2 cut(s) 225, 270
SetI ASST 8 cut(s) 32, 57, 100, 106, 267, 307, 336, 345
SfcI CTRYAG 1 cut(s) 99
SfuI TTCGAA 1 cut(s) 203
SinI GGWCC 1 cut(s) 305
SmiMI CAYNNNNRTG 1 cut(s) 252
SmlI CTYRAG 1 cut(s) 60
SmoI CTYRAG 1 cut(s) 60
Sse9I AATT 3 cut(s) 5, 168, 191
SsiI CCGC 2 cut(s) 79, 328
SspMI CTAG 1 cut(s) 24
StyD4I CCNGG 2 cut(s) 223, 268
StyI CCWWGG 2 cut(s) 108, 348
TaaI ACNGT 2 cut(s) 260, 298
TaqI TCGA 1 cut(s) 203
TasI AATT 3 cut(s) 5, 168, 191
Tru1I TTAA 3 cut(s) 218, 339, 382
Tru9I TTAA 3 cut(s) 218, 339, 382
TscAI CASTG 2 cut(s) 54, 303
TseFI GTSAC 4 cut(s) 19, 182, 254, 260
TseI GCWGC 4 cut(s) 41, 98, 101, 104
Tsp45I GTSAC 4 cut(s) 19, 182, 254, 260
TspRI CASTG 2 cut(s) 54, 303
VpaK11BI GGWCC 1 cut(s) 305
XagI CCTNNNNNAGG 1 cut(s) 347
XapI RAATTY 1 cut(s) 5
XmnI GAANNNNTTC 1 cut(s) 123
XspI CTAG 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.