RchiOBHm_Chr7g0189031

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
8433911 .. 8434291
381 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16882

Sequence Viewer

Length: 129 bp
ATGAAGGAAGGAGTTCGAATGGTTGTTGGTGGTGGAGGACTACACTTATTTAGAATTGGCCTTCTATTTGGAGATGAAGAATTGTTAGGAAGTGACGAATTGATTACCATTGTGGAAACGTCTTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

42

Amino Acids

4.55

Weight (kDa)

4.49

Isoelectric Point (pI)

22.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AoxI GGCC 1 cut(s) 58
Asp700I GAANNNNTTC 1 cut(s) 12
AsuII TTCGAA 1 cut(s) 16
BfaI CTAG 1 cut(s) 127
Bpu14I TTCGAA 1 cut(s) 16
BshFI GGCC 1 cut(s) 60
BsnI GGCC 1 cut(s) 60
Bsp119I TTCGAA 1 cut(s) 16
BspANI GGCC 1 cut(s) 60
BspT104I TTCGAA 1 cut(s) 16
BstBI TTCGAA 1 cut(s) 16
BsuRI GGCC 1 cut(s) 60
CviJI RGCY 1 cut(s) 60
CviKI_1 RGCY 1 cut(s) 60
FspBI CTAG 1 cut(s) 127
HaeIII GGCC 1 cut(s) 60
HpyAV CCTTC 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 119
HpySE526I ACGT 1 cut(s) 119
MaeI CTAG 1 cut(s) 127
MaeII ACGT 1 cut(s) 119
MaeIII GTNAC 1 cut(s) 92
MboII GAAGA 1 cut(s) 89
MluCI AATT 3 cut(s) 54, 80, 98
MnlI CCTC 1 cut(s) 29
MroXI GAANNNNTTC 1 cut(s) 12
NmuCI GTSAC 1 cut(s) 92
NspV TTCGAA 1 cut(s) 16
PdmI GAANNNNTTC 1 cut(s) 12
SetI ASST 1 cut(s) 122
SfuI TTCGAA 1 cut(s) 16
Sse9I AATT 3 cut(s) 54, 80, 98
SspMI CTAG 1 cut(s) 127
TaiI ACGT 1 cut(s) 122
TaqI TCGA 1 cut(s) 16
TasI AATT 3 cut(s) 54, 80, 98
TseFI GTSAC 1 cut(s) 92
Tsp45I GTSAC 1 cut(s) 92
TspDTI ATGAA 2 cut(s) 17, 90
XmnI GAANNNNTTC 1 cut(s) 12
XspI CTAG 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.