Rh4CG150600

Microtubule associated protein (MAP65/ASE1 family)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0001938
Physical Location & Seq
Forward (+)
33200589 .. 33201323
735 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG150600.1

Sequence Viewer

Length: 315 bp
ATGGTGGTGGAAGCAGAGACCGACTTATCCTTGAAAAGGCTAGAAGAACTACACAGGCAGTTGCTTGAATATCAAGATGAGAAGAGGAACCGTTTGAAGCTTATAATGGACCACATGAGCATGCTAAACTCCCTGTGCTTTGTTCTTGGTATGGATTTTAAACACACAATTCATGAAATCCACCCCACCTTAGATGATCTTAATGGAGAAAAAGACGTAACAAACAGCACAATCGAGGGTTTGGCTAATTCGGTTCAGATATTGAGAGAGGTCAAGATACAGAGATGGCAGAGGGTTAGTATGTCTGTAAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MAP65_ASE1

Protein Analysis

104

Amino Acids

12.23

Weight (kDa)

5.92

Isoelectric Point (pI)

38.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MAP65_ASE1 PF03999 4 - 99 1.4e-08 Microtubule associated protein (MAP65/ASE1 family)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 104
AfiI CCNNNNNNNGG 1 cut(s) 36
AgsI TTSAA 3 cut(s) 34, 68, 97
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
Alw26I GTCTC 1 cut(s) 11
AspS9I GGNCC 1 cut(s) 109
AvaII GGWCC 1 cut(s) 109
BccI CCATC 1 cut(s) 279
BcoDI GTCTC 1 cut(s) 11
BfaI CTAG 1 cut(s) 41
Bme18I GGWCC 1 cut(s) 109
BmgT120I GGNCC 1 cut(s) 109
BmiI GGNNCC 1 cut(s) 89
BsaI GGTCTC 1 cut(s) 11
Bsc4I CCNNNNNNNGG 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 36
BslI CCNNNNNNNGG 1 cut(s) 36
BsmAI GTCTC 1 cut(s) 11
Bso31I GGTCTC 1 cut(s) 11
Bsp143I GATC 1 cut(s) 196
BspHI TCATGA 1 cut(s) 172
BspLI GGNNCC 1 cut(s) 89
BspTNI GGTCTC 1 cut(s) 11
BssMI GATC 1 cut(s) 196
Bst4CI ACNGT 1 cut(s) 92
Bst6I CTCTTC 1 cut(s) 77
BstC8I GCNNGC 1 cut(s) 122
BstDEI CTNAG 1 cut(s) 190
BstENI CCTNNNNNAGG 1 cut(s) 34
BstKTI GATC 1 cut(s) 199
BstMAI GTCTC 1 cut(s) 11
BstMBI GATC 1 cut(s) 196
BstNSI RCATGY 1 cut(s) 124
Cac8I GCNNGC 1 cut(s) 122
CciI TCATGA 1 cut(s) 172
Cfr13I GGNCC 1 cut(s) 109
CviAII CATG 3 cut(s) 115, 121, 173
CviJI RGCY 3 cut(s) 40, 100, 245
CviKI_1 RGCY 3 cut(s) 40, 100, 245
DdeI CTNAG 1 cut(s) 190
DpnI GATC 1 cut(s) 198
DpnII GATC 1 cut(s) 196
DraI TTTAAA 1 cut(s) 160
Eam1104I CTCTTC 1 cut(s) 77
EarI CTCTTC 1 cut(s) 77
Eco31I GGTCTC 1 cut(s) 11
Eco47I GGWCC 1 cut(s) 109
EcoNI CCTNNNNNAGG 1 cut(s) 34
FaeI CATG 3 cut(s) 118, 124, 176
FaiI YATR 6 cut(s) 104, 116, 122, 152, 174, 302
FatI CATG 3 cut(s) 114, 120, 172
FspBI CTAG 1 cut(s) 41
Hin1II CATG 3 cut(s) 118, 124, 176
HindIII AAGCTT 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 258
Hpy188III TCNNGA 3 cut(s) 74, 173, 274
HpyCH4III ACNGT 1 cut(s) 92
HpyCH4IV ACGT 1 cut(s) 216
HpyF3I CTNAG 1 cut(s) 190
HpySE526I ACGT 1 cut(s) 216
Hsp92II CATG 3 cut(s) 118, 124, 176
Kzo9I GATC 1 cut(s) 196
LpnPI CCDG 2 cut(s) 40, 146
MaeI CTAG 1 cut(s) 41
MaeII ACGT 1 cut(s) 216
MaeIII GTNAC 1 cut(s) 217
MalI GATC 1 cut(s) 198
MboI GATC 1 cut(s) 196
MboII GAAGA 2 cut(s) 56, 94
MluCI AATT 2 cut(s) 168, 247
MnlI CCTC 4 cut(s) 78, 229, 262, 285
MseI TTAA 2 cut(s) 159, 201
MslI CAYNNNNRTG 1 cut(s) 119
NdeII GATC 1 cut(s) 196
NlaIII CATG 3 cut(s) 118, 124, 176
NlaIV GGNNCC 1 cut(s) 89
NspI RCATGY 1 cut(s) 124
PaeI GCATGC 1 cut(s) 124
PagI TCATGA 1 cut(s) 172
PsiI TTATAA 1 cut(s) 104
PspN4I GGNNCC 1 cut(s) 89
PspPI GGNCC 1 cut(s) 109
RseI CAYNNNNRTG 1 cut(s) 119
SaqAI TTAA 2 cut(s) 159, 201
Sau3AI GATC 1 cut(s) 196
Sau96I GGNCC 1 cut(s) 109
SetI ASST 4 cut(s) 102, 191, 219, 273
SinI GGWCC 1 cut(s) 109
SmiMI CAYNNNNRTG 1 cut(s) 119
SphI GCATGC 1 cut(s) 124
Sse9I AATT 2 cut(s) 168, 247
SspMI CTAG 1 cut(s) 41
TaaI ACNGT 1 cut(s) 92
TaiI ACGT 1 cut(s) 219
TaqI TCGA 1 cut(s) 234
TaqII GACCGA 1 cut(s) 35
TasI AATT 2 cut(s) 168, 247
Tru1I TTAA 2 cut(s) 159, 201
Tru9I TTAA 2 cut(s) 159, 201
TspDTI ATGAA 2 cut(s) 161, 189
VpaK11BI GGWCC 1 cut(s) 109
XagI CCTNNNNNAGG 1 cut(s) 34
XceI RCATGY 1 cut(s) 124
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.