Rh4CG150500

microtubule binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0001938
Physical Location & Seq
Forward (+)
33199831 .. 33200513
683 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG150500.1

Sequence Viewer

Length: 231 bp
ATGTGCGTGGAGGTGTTTAGGGCAAAAGTTGACGAGGCGGAACAGTGTAAAGCTGAACTACAGCAAGCAATTGCTAATTGTGAAGCAAAGTTTGTAGACATATGTGCTGTCCTGGGTGAGAAACCACCACATTTTGATCATAAGATCAGTGGAAGTTTGAAGAAAGAGCTTGAAATCATTATCCCACAATTCGAGGTCATGAAGAAGCGGAAAATTGAAAGGAAGGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MAP65_ASE1

Protein Analysis

76

Amino Acids

8.73

Weight (kDa)

6.72

Isoelectric Point (pI)

26.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MAP65_ASE1 PF03999 2 - 75 5.1e-08 Microtubule associated protein (MAP65/ASE1 family)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 96
AciI CCGC 2 cut(s) 38, 208
AgsI TTSAA 3 cut(s) 160, 173, 218
AjnI CCWGG 1 cut(s) 111
AluBI AGCT 2 cut(s) 53, 169
AluI AGCT 2 cut(s) 53, 169
AsuHPI GGTGA 1 cut(s) 128
BciT130I CCWGG 1 cut(s) 113
BclI TGATCA 1 cut(s) 136
BfmI CTRYAG 1 cut(s) 59
Bme1390I CCNGG 1 cut(s) 113
BmrFI CCNGG 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 112
BseBI CCWGG 1 cut(s) 113
BseDI CCNNGG 1 cut(s) 112
Bsp143I GATC 2 cut(s) 136, 144
BspACI CCGC 2 cut(s) 38, 208
BspHI TCATGA 1 cut(s) 198
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 2 cut(s) 136, 144
Bst2UI CCWGG 1 cut(s) 113
Bst4CI ACNGT 1 cut(s) 45
BstC8I GCNNGC 1 cut(s) 66
BstKTI GATC 2 cut(s) 139, 147
BstMBI GATC 2 cut(s) 136, 144
BstNI CCWGG 1 cut(s) 113
BstSCI CCNGG 1 cut(s) 111
BstSFI CTRYAG 1 cut(s) 59
BtsIMutI CAGTG 2 cut(s) 50, 154
Cac8I GCNNGC 1 cut(s) 66
CciI TCATGA 1 cut(s) 198
CviAII CATG 1 cut(s) 199
CviJI RGCY 2 cut(s) 53, 169
CviKI_1 RGCY 2 cut(s) 53, 169
DpnI GATC 2 cut(s) 138, 146
DpnII GATC 2 cut(s) 136, 144
EciI GGCGGA 1 cut(s) 53
EcoRII CCWGG 1 cut(s) 111
FaeI CATG 1 cut(s) 202
FaiI YATR 4 cut(s) 101, 103, 141, 200
FatI CATG 1 cut(s) 198
FauNDI CATATG 1 cut(s) 101
FbaI TGATCA 1 cut(s) 136
FblI GTMKAC 1 cut(s) 96
Hin1II CATG 1 cut(s) 202
HincII GTYRAC 1 cut(s) 31
HindII GTYRAC 1 cut(s) 31
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 2 cut(s) 31, 97
Hpy188III TCNNGA 1 cut(s) 199
Hpy8I GTNNAC 2 cut(s) 31, 97
HpyAV CCTTC 1 cut(s) 217
HpyCH4III ACNGT 1 cut(s) 45
Hsp92II CATG 1 cut(s) 202
Ksp22I TGATCA 1 cut(s) 136
Kzo9I GATC 2 cut(s) 136, 144
LpnPI CCDG 2 cut(s) 98, 125
MalI GATC 2 cut(s) 138, 146
MboI GATC 2 cut(s) 136, 144
MboII GAAGA 2 cut(s) 172, 214
MfeI CAATTG 1 cut(s) 69
MluCI AATT 4 cut(s) 69, 76, 188, 213
MnlI CCTC 3 cut(s) 4, 28, 187
MspR9I CCNGG 1 cut(s) 113
MunI CAATTG 1 cut(s) 69
MvaI CCWGG 1 cut(s) 113
NdeI CATATG 1 cut(s) 101
NdeII GATC 2 cut(s) 136, 144
NlaIII CATG 1 cut(s) 202
PagI TCATGA 1 cut(s) 198
Psp6I CCWGG 1 cut(s) 111
PspGI CCWGG 1 cut(s) 111
Sau3AI GATC 2 cut(s) 136, 144
ScrFI CCNGG 1 cut(s) 113
SetI ASST 4 cut(s) 15, 55, 171, 198
SfcI CTRYAG 1 cut(s) 59
SgeI CNNG 8 cut(s) 19, 46, 77, 124, 125, 182, 205, 211
Sse9I AATT 4 cut(s) 69, 76, 188, 213
SsiI CCGC 2 cut(s) 38, 208
StyD4I CCNGG 1 cut(s) 111
TaaI ACNGT 1 cut(s) 45
TaqI TCGA 1 cut(s) 192
TasI AATT 4 cut(s) 69, 76, 188, 213
TscAI CASTG 2 cut(s) 50, 154
TspDTI ATGAA 1 cut(s) 215
TspRI CASTG 2 cut(s) 50, 154
XmiI GTMKAC 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.